ID: 1157786178

View in Genome Browser
Species Human (GRCh38)
Location 18:50485038-50485060
Sequence GTCTTCTCCAGTAGAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157786173_1157786178 11 Left 1157786173 18:50485004-50485026 CCACACTCCAGGGAACGCAGCAA No data
Right 1157786178 18:50485038-50485060 GTCTTCTCCAGTAGAGAGGGAGG No data
1157786174_1157786178 4 Left 1157786174 18:50485011-50485033 CCAGGGAACGCAGCAACTACCAG No data
Right 1157786178 18:50485038-50485060 GTCTTCTCCAGTAGAGAGGGAGG No data
1157786172_1157786178 18 Left 1157786172 18:50484997-50485019 CCTCACTCCACACTCCAGGGAAC No data
Right 1157786178 18:50485038-50485060 GTCTTCTCCAGTAGAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157786178 Original CRISPR GTCTTCTCCAGTAGAGAGGG AGG Intergenic
No off target data available for this crispr