ID: 1157787237

View in Genome Browser
Species Human (GRCh38)
Location 18:50494901-50494923
Sequence ATGAAAACCCTTTGATCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157787231_1157787237 19 Left 1157787231 18:50494859-50494881 CCTTCCTCCCAATAACAGAATCT No data
Right 1157787237 18:50494901-50494923 ATGAAAACCCTTTGATCTCAGGG No data
1157787234_1157787237 12 Left 1157787234 18:50494866-50494888 CCCAATAACAGAATCTTGGTTTA No data
Right 1157787237 18:50494901-50494923 ATGAAAACCCTTTGATCTCAGGG No data
1157787228_1157787237 30 Left 1157787228 18:50494848-50494870 CCTGCCACCTACCTTCCTCCCAA No data
Right 1157787237 18:50494901-50494923 ATGAAAACCCTTTGATCTCAGGG No data
1157787233_1157787237 15 Left 1157787233 18:50494863-50494885 CCTCCCAATAACAGAATCTTGGT No data
Right 1157787237 18:50494901-50494923 ATGAAAACCCTTTGATCTCAGGG No data
1157787229_1157787237 26 Left 1157787229 18:50494852-50494874 CCACCTACCTTCCTCCCAATAAC No data
Right 1157787237 18:50494901-50494923 ATGAAAACCCTTTGATCTCAGGG No data
1157787230_1157787237 23 Left 1157787230 18:50494855-50494877 CCTACCTTCCTCCCAATAACAGA No data
Right 1157787237 18:50494901-50494923 ATGAAAACCCTTTGATCTCAGGG No data
1157787235_1157787237 11 Left 1157787235 18:50494867-50494889 CCAATAACAGAATCTTGGTTTAC No data
Right 1157787237 18:50494901-50494923 ATGAAAACCCTTTGATCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157787237 Original CRISPR ATGAAAACCCTTTGATCTCA GGG Intergenic
No off target data available for this crispr