ID: 1157790650

View in Genome Browser
Species Human (GRCh38)
Location 18:50528218-50528240
Sequence CTGGCTTTTGAAGGAGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157790638_1157790650 25 Left 1157790638 18:50528170-50528192 CCAGAGGAAGCAGGCAGGACAAG No data
Right 1157790650 18:50528218-50528240 CTGGCTTTTGAAGGAGGAGCAGG No data
1157790643_1157790650 2 Left 1157790643 18:50528193-50528215 CCACAATGGGGAGGCAGCCTGTG No data
Right 1157790650 18:50528218-50528240 CTGGCTTTTGAAGGAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157790650 Original CRISPR CTGGCTTTTGAAGGAGGAGC AGG Intergenic
No off target data available for this crispr