ID: 1157794645

View in Genome Browser
Species Human (GRCh38)
Location 18:50562093-50562115
Sequence CTGCTCAAAAGCAGAATTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 1, 2: 2, 3: 15, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157794645 Original CRISPR CTGCTCAAAAGCAGAATTCT AGG (reversed) Intronic
900183440 1:1322515-1322537 CTGCTCAAAAGTTGGCTTCTCGG - Intronic
901668991 1:10843115-10843137 CTGCTCAAATGCCACATTCTTGG + Intergenic
905502022 1:38447002-38447024 CTTCTCAACAGCAGTACTCTTGG + Intergenic
905551520 1:38844512-38844534 CTTCTCTGAAGCTGAATTCTTGG - Intronic
905945695 1:41900000-41900022 CTGCCCTAAAGCAGATTTATTGG + Intronic
908045834 1:60167471-60167493 CTACTCTAAAGCACAATGCTAGG + Intergenic
908647186 1:66290821-66290843 CTGCTCAGAAGCAGAAACCATGG + Intronic
909865176 1:80659712-80659734 TTGCTGTAAAGCAAAATTCTTGG - Intergenic
911174916 1:94809111-94809133 CTGCACAAATGCAGAAATGTAGG + Intergenic
912119971 1:106459004-106459026 CTGCACAGAAGCAGAGTTCTCGG + Intergenic
913535988 1:119773002-119773024 CAGCTGAAAAGCTGAAGTCTAGG - Intergenic
913733971 1:121753124-121753146 CTGCTAGACAGAAGAATTCTCGG + Intergenic
913734094 1:121755498-121755520 CTGCTAGACAGAAGAATTCTCGG + Intergenic
913840698 1:123417629-123417651 CTGCTAGAAAGAAGAATTCTCGG + Intergenic
913846758 1:123526566-123526588 CTGCTAGACAGAAGAATTCTCGG + Intergenic
913855033 1:123675441-123675463 CTGCTAGACAGAAGAATTCTCGG + Intergenic
913872986 1:123997635-123997657 CTGCTAGACAGAAGAATTCTCGG + Intergenic
913906219 1:124592702-124592724 CTGCTAGACAGAAGAATTCTCGG + Intergenic
916288797 1:163140684-163140706 TTGCTTCCAAGCAGAATTCTTGG - Intronic
917971715 1:180212196-180212218 CTGCCCAAAAGCAGCATATTCGG - Intergenic
918176260 1:182048340-182048362 CTGATCAACAGCACAATTGTTGG + Intergenic
918845234 1:189601121-189601143 CTGCTTAAAACTAGAATTTTTGG - Intergenic
920335066 1:205239520-205239542 CTTCTCAAGAACTGAATTCTGGG - Intronic
920497957 1:206468829-206468851 CTGCCAGAAAGCAGAGTTCTGGG + Intergenic
921597683 1:217072642-217072664 CTGCTCAAAAGAATCATTATAGG - Intronic
923256664 1:232227375-232227397 CTGCCCAAAAGCTGTATTGTTGG + Intergenic
923382361 1:233434268-233434290 CATCTCAAAAGCCCAATTCTAGG + Intergenic
923948182 1:238914946-238914968 CTGCTCAAAAGTTAATTTCTCGG - Intergenic
924374884 1:243395514-243395536 CTACTCAAAATATGAATTCTAGG - Intronic
1063351040 10:5355289-5355311 CTGCTCCTAAGCAGAATTTCAGG + Intergenic
1063520579 10:6737232-6737254 CAGCTCACAGGCAGAATTCCAGG + Intergenic
1064313044 10:14228835-14228857 CTGTTCAAAAGCAGAATTCTAGG + Intronic
1064672337 10:17729468-17729490 CTTCTAAAAACCAGAATGCTCGG + Intergenic
1066094490 10:32059157-32059179 CAGCTCAAGATCAGATTTCTGGG - Intergenic
1066825830 10:39574567-39574589 CTGCTATACAGAAGAATTCTCGG + Intergenic
1067820604 10:49525932-49525954 CAGCTCAAAAGCATAATGTTGGG - Intronic
1068535308 10:58235021-58235043 CTTCTCAAAAGAAGACATCTAGG + Intronic
1069502903 10:68970328-68970350 CTGCTTTATAGCTGAATTCTGGG - Exonic
1069825961 10:71255272-71255294 ATTCCCAAAAGTAGAATTCTAGG + Intronic
1071365005 10:84890585-84890607 CTCCTCTATAGCAGAGTTCTGGG + Intergenic
1072806705 10:98428082-98428104 CTGTTGAGAAGCAGAGTTCTGGG - Intronic
1074080824 10:110166857-110166879 CTATTCAAAAGCAGATTCCTGGG - Intergenic
1074336654 10:112583129-112583151 ATGATCAAGAGCAGAGTTCTTGG + Intronic
1074406152 10:113181777-113181799 CTGATCAAGAGCAGCCTTCTGGG + Intergenic
1075221775 10:120591067-120591089 CTGCCCAAAAGCAACACTCTTGG - Intergenic
1075246650 10:120828466-120828488 ATGCTCCAAATCAGAATTTTTGG - Intergenic
1078100519 11:8327882-8327904 CTGCTCTCTGGCAGAATTCTAGG + Intergenic
1078898262 11:15617249-15617271 CTGATCAGAAACAGACTTCTAGG + Intergenic
1080004328 11:27390468-27390490 CTGCTAAAATGCAGAACCCTAGG - Intronic
1082712722 11:56573796-56573818 TAGCACAAAAGCAGATTTCTTGG - Intergenic
1085541391 11:77273649-77273671 CTGCTTAATACCTGAATTCTAGG - Intronic
1087676975 11:101174892-101174914 GTGCTATAAAGCAGAATTATAGG - Intergenic
1090969730 11:131630009-131630031 CTGCTTGAAAGGAGAATTCTGGG - Intronic
1092436656 12:8452724-8452746 CAGAGCAAAAGCAGAATTGTGGG - Intergenic
1093412004 12:18878525-18878547 CTGCTCCTTAGCAGATTTCTTGG - Intergenic
1093987258 12:25549631-25549653 CCTTTGAAAAGCAGAATTCTGGG - Intronic
1094079267 12:26514925-26514947 CTGATCAAAGGCTGATTTCTTGG - Intronic
1095165220 12:38964251-38964273 CTTCTCAAAAGAAGACATCTAGG - Intergenic
1095498893 12:42815035-42815057 CTGTTTAAAAGCAGAGTTCCTGG + Intergenic
1095523298 12:43094339-43094361 CTGCTCACAAGGAGACCTCTTGG + Intergenic
1095548833 12:43408509-43408531 CTACTTAAAAGCATAGTTCTTGG - Intronic
1095627210 12:44330026-44330048 ATACTCAAAAGTAGAATTCCTGG + Intronic
1096014065 12:48251316-48251338 ATACTCAAAAGTAAAATTCTGGG - Intergenic
1097294607 12:57949169-57949191 ATGCTCAAGAGCAGAATTACTGG + Intronic
1098332561 12:69369135-69369157 CTGTTAAAAAGCAGTTTTCTTGG - Intronic
1101057496 12:100933887-100933909 CTTCTCAAAAGAAGACATCTAGG - Intronic
1101615907 12:106336809-106336831 CTCTTCAATAGCACAATTCTAGG - Intronic
1103212845 12:119179185-119179207 CTGCAGAAAAGCAGCATTTTCGG + Exonic
1103336262 12:120192389-120192411 CTGGCCAAATACAGAATTCTAGG + Intronic
1106118284 13:26836275-26836297 CTGCTCAAAATCAGATATCATGG + Intergenic
1106315673 13:28591175-28591197 CTAATCAAGAGCAGCATTCTGGG - Intergenic
1107341708 13:39414097-39414119 TTGCTCAAAAAAATAATTCTGGG + Intronic
1107420807 13:40244721-40244743 CTGCTCAAATGCTGCCTTCTCGG - Intergenic
1108270072 13:48750832-48750854 CTGCAGAAAAGCAGCTTTCTGGG + Intergenic
1108451443 13:50569970-50569992 CTGCTAAAAGGGAGAAATCTAGG - Intronic
1109987871 13:70013703-70013725 CTGTTCAAAAACAAATTTCTAGG + Intronic
1113136775 13:107099490-107099512 CTTTTCTAAAGAAGAATTCTAGG + Intergenic
1113454897 13:110441368-110441390 ATGGTCAAAAGCAGAATGCTGGG - Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1116368109 14:44094788-44094810 CAGATCATAAGCAGAAATCTGGG - Intergenic
1117903684 14:60562254-60562276 GTGCTGAAAAGCTGAGTTCTTGG - Intergenic
1118767469 14:68919607-68919629 CTTCTCAAAGGCAGAAACCTTGG - Intronic
1119431720 14:74572654-74572676 GAGCTCAAAAGGAGAATTCACGG + Intronic
1121230341 14:92352925-92352947 CTTCTGAAAAGCAGAATGTTGGG - Intronic
1121518693 14:94570808-94570830 ATGTTCAAAACCAGAATTCCTGG + Intronic
1124154299 15:27211750-27211772 AAGCACAAAAGCACAATTCTAGG - Intronic
1124156714 15:27232623-27232645 ATGATTAAAAGCAGAATTGTAGG - Intronic
1124325636 15:28759436-28759458 CTGCTCAAAAGAAGAACTAGTGG - Intergenic
1125986803 15:44061435-44061457 TTGCTAAAAAGCAGTAATCTTGG - Intronic
1126114335 15:45195298-45195320 ATTCTCAAAAGTAGAAATCTTGG + Intronic
1127625222 15:60773867-60773889 CTTTTCAAAAACAGAGTTCTTGG - Intronic
1130374657 15:83318068-83318090 CTTCTCACCAACAGAATTCTTGG - Intergenic
1133727510 16:8551152-8551174 CTGGTAAAAACCAGAATTCTAGG - Intergenic
1134772017 16:16817285-16817307 CTGCTGAAAAGCAGACTTAGTGG + Intergenic
1135999554 16:27281418-27281440 CTGATCAAAGGCTGAATTCAGGG + Intronic
1139263012 16:65613202-65613224 CTGCTAAAATGCAGATTGCTGGG + Intergenic
1140589256 16:76332061-76332083 GTCCTCAACAGCAGATTTCTGGG - Intronic
1140888333 16:79263807-79263829 CAGCTTAAGAGCAGAACTCTTGG - Intergenic
1143289651 17:5819402-5819424 TTGCTAAAATGCAGAATCCTAGG + Intronic
1145871208 17:28274924-28274946 CTGATCAAAATCAGATTTCATGG - Intergenic
1153330999 18:3874506-3874528 CTTTTAAAAAGCAGAATTCTTGG - Intronic
1155447813 18:25930218-25930240 TTTCTTAAAAGCAGAATTGTGGG - Intergenic
1156105459 18:33654256-33654278 CTTCTCAAAAACAGAATTGAAGG + Intronic
1156783105 18:40875988-40876010 CTGCACAAAAGCAGAGGGCTTGG - Intergenic
1157479515 18:48044495-48044517 CTGCCCAAAGGCAGCCTTCTTGG - Intronic
1157794645 18:50562093-50562115 CTGCTCAAAAGCAGAATTCTAGG - Intronic
1159835865 18:73334605-73334627 TTGATGCAAAGCAGAATTCTTGG - Intergenic
1162756430 19:12863351-12863373 GTGCTCAAATGCAGATTCCTGGG + Intronic
1163859631 19:19735073-19735095 ATGCTCAGAAGCAGACTTCCTGG + Intergenic
1165707548 19:37987304-37987326 CATCTGAAAAGCAGACTTCTAGG - Intronic
1165829238 19:38722355-38722377 CTGCTCAAAAATAGGATCCTTGG + Intronic
1166903869 19:46089703-46089725 ATGCTCACCAGCAGACTTCTCGG - Intergenic
1167227911 19:48261448-48261470 CAGATCAAAACAAGAATTCTGGG - Intronic
928196630 2:29220993-29221015 CTGCTCACCAGCAAGATTCTGGG - Intronic
929377435 2:41306106-41306128 CTGCTCAAAGTATGAATTCTAGG - Intergenic
932086666 2:68768751-68768773 CTTATCAAAAGCAAAACTCTCGG + Intronic
932559867 2:72857633-72857655 CTGCTCAGATCCAGAATGCTGGG + Intergenic
936837893 2:116730004-116730026 CTGCCCAAAACCAGAATGCTAGG - Intergenic
938589660 2:132724141-132724163 CTGCTCAAAAGTCGCTTTCTTGG + Intronic
939723555 2:145685393-145685415 CTGCTCAAATGCTGAAATCCAGG - Intergenic
939753535 2:146079545-146079567 CAGTTCAAAAGCAACATTCTGGG - Intergenic
942224765 2:173805360-173805382 CTGTTCAAATGCAGACATCTGGG + Intergenic
944013556 2:195004093-195004115 CTGTTCAAAAGCACAATGTTTGG + Intergenic
944272690 2:197801587-197801609 CTGCTCTAAAATGGAATTCTAGG + Intergenic
945303869 2:208240135-208240157 CTTCTGAAAGGCAGAATTATTGG - Intronic
945451695 2:210002193-210002215 CAGCTCAAAAGAAGAGCTCTAGG + Intergenic
946942068 2:224779834-224779856 CTACTCCATAGCAGAATTCTTGG + Intronic
947837417 2:233185655-233185677 CTGCACAAAAACAGAATCCCCGG + Intronic
1168854679 20:1000481-1000503 CTGCTCATAAGGAGGATTGTGGG - Intronic
1173338546 20:42133839-42133861 CTGCTCTAAAGAAAAATGCTAGG + Intronic
1176057682 20:63157369-63157391 CTCCTCAGAAACAGAATCCTAGG + Intergenic
1176167115 20:63680173-63680195 TTTCTCAAAAGCAGAATAATGGG - Intronic
1178263043 21:31117405-31117427 CTGCTCAACATCAGAATGTTTGG + Intergenic
1178697970 21:34810324-34810346 CTGCTTAAAACCAGAATCCCTGG - Intronic
1179146249 21:38770544-38770566 GTGATCAAAAGCTGATTTCTAGG - Intergenic
1180697085 22:17758434-17758456 ATACCCAAAAGCTGAATTCTAGG - Intronic
1181411134 22:22720629-22720651 GGGCTCAGAAGCAGAGTTCTGGG + Intergenic
1182814940 22:33153962-33153984 ATTCTCATAAGCAGAAATCTGGG + Intergenic
1184544194 22:45155032-45155054 CTGCTCAAAGTCACAATGCTAGG + Intergenic
950138227 3:10598034-10598056 CTGCTCAAAGGCAGATATCAGGG + Intronic
950197493 3:11019128-11019150 CTACTCAGAAGCAGAATTGCTGG - Intronic
951277548 3:20707084-20707106 ATTTTCAAAAGCAAAATTCTAGG - Intergenic
951661754 3:25074337-25074359 CTGCTGAAAATCAGAATGATAGG + Intergenic
952608547 3:35180067-35180089 ATGCCCAAGAGTAGAATTCTTGG - Intergenic
955082270 3:55668781-55668803 CTGGTCATAAGAAGAATTCAAGG - Intronic
955364227 3:58298036-58298058 CTCCTCCAAAGCAGAAGGCTGGG - Intergenic
957264490 3:77944830-77944852 TTGCTTACATGCAGAATTCTGGG - Intergenic
957400017 3:79699380-79699402 CATCTGAAAAGCAGATTTCTCGG + Intronic
960484989 3:118240675-118240697 GTGATCAAAGGCAGAATTATAGG - Intergenic
961055313 3:123783194-123783216 AGTGTCAAAAGCAGAATTCTTGG + Intronic
963062395 3:141235215-141235237 CTTCTCAAAACCAGAATGATGGG - Intronic
963350005 3:144140176-144140198 GTCCTCAAAAGCAGCATTGTTGG - Intergenic
963775252 3:149432656-149432678 CTGCTAAACAGCAGAACTATTGG - Intergenic
964477227 3:157107954-157107976 CTGCTAAAAATCAGATTTCTTGG - Intergenic
966220591 3:177547451-177547473 CTGCTGAAAAGCCGATGTCTTGG + Intergenic
968839034 4:2987638-2987660 GTACTCAGAAGCAGAATTGTTGG + Intronic
968895347 4:3397640-3397662 CATGTCCAAAGCAGAATTCTTGG - Intronic
970044674 4:11838364-11838386 ACTCTCAAAAGCAGAAATCTTGG + Intergenic
971502519 4:27332314-27332336 ATGCTCAAAAGTGGAAGTCTGGG + Intergenic
973197748 4:47464645-47464667 CTACTCATTAGCAGCATTCTAGG + Intergenic
974252020 4:59397412-59397434 GAGATCAAGAGCAGAATTCTCGG - Intergenic
975322572 4:73025210-73025232 CTATCCAATAGCAGAATTCTTGG + Intergenic
975419320 4:74143923-74143945 ATACTCAAAAACAAAATTCTAGG - Intronic
976526959 4:86103449-86103471 CAGCTAAAAAGCTCAATTCTTGG + Intronic
977304068 4:95301155-95301177 TGGCTCAAATGCAGAAATCTGGG + Intronic
977400477 4:96524844-96524866 TTGCTTGAAGGCAGAATTCTTGG - Intergenic
979083395 4:116373290-116373312 CTGCTCAGAAGAAGAATGATTGG + Intergenic
979342819 4:119547803-119547825 TTTCTGAAAAGCAGAATTGTTGG - Intronic
980708910 4:136538684-136538706 ATAGTAAAAAGCAGAATTCTAGG + Intergenic
981451345 4:144901095-144901117 GTGCACAAAAGCACAATTATGGG + Intergenic
981890693 4:149732903-149732925 CTGCTCAAAAACAGAATTCAGGG + Intergenic
983156918 4:164359873-164359895 CTGCTAAAAACCAGATTTCTGGG - Intronic
984228169 4:177061129-177061151 CTGCTGTAAAGCTGAAATCTTGG + Intergenic
984640397 4:182158569-182158591 CTGCTTTAAAGCAGAAACCTAGG + Intronic
986875766 5:12106769-12106791 CAGGTTAAAAGCAGAATTCTGGG + Intergenic
987133137 5:14877755-14877777 CTGCTTCAGAGCAGAATGCTGGG - Intergenic
987395522 5:17419524-17419546 CTGCTAAAATACAGATTTCTGGG - Intergenic
988897096 5:35688191-35688213 CTGCTGAAGAGCAGAGTTCCTGG - Intronic
989290816 5:39762814-39762836 CTGCTCAAAAGCAAATGTTTAGG + Intergenic
989951776 5:50307884-50307906 CTTCTCAAAAGAAGAAATTTAGG - Intergenic
990822177 5:59854028-59854050 CTTCTCAAAAGTATAATTATTGG + Intronic
991099370 5:62775820-62775842 CATTCCAAAAGCAGAATTCTGGG + Intergenic
995367914 5:111384670-111384692 CTGCTCAGAGGAAGAATTATAGG - Intronic
997160546 5:131604756-131604778 TTGCTTAAAATCAGAATTGTGGG - Intronic
998792791 5:145783510-145783532 CTGTTAAAAATCAGAATTCTTGG + Intronic
999043780 5:148445624-148445646 TTGCTCAAAAGCACACATCTAGG + Intergenic
1001582775 5:172810438-172810460 CTTGCCCAAAGCAGAATTCTGGG + Intergenic
1001692255 5:173641896-173641918 CTGCTAAAAGGCAGATTTCTGGG + Intergenic
1005773227 6:29098669-29098691 CTGCTAAAAAGCAGATCTTTTGG + Intergenic
1005779212 6:29170862-29170884 CTGCTAAAAAGCAGATCTTTTGG + Intergenic
1006735811 6:36271680-36271702 CTCCTGAAAAGGAGAATTCCTGG + Intronic
1007889484 6:45272871-45272893 CTGGTCAAGAGCAGAAGTCATGG - Intronic
1008148163 6:47917103-47917125 TTGCTCAAAAGTAGTATTATTGG - Intronic
1008160526 6:48069424-48069446 TCGCTGAAAAGCAGAATTCGAGG - Intergenic
1008585927 6:52948871-52948893 CTTCTAAAAAGCAAAAATCTAGG + Intergenic
1009196287 6:60689816-60689838 ATACTCAAAAGCAGAATTGCTGG + Intergenic
1009275112 6:61667005-61667027 TTTCTCAAAAGAAGGATTCTTGG + Intergenic
1010770058 6:79817654-79817676 CTGCTCAAAACCAGAAAAATTGG - Intergenic
1012859125 6:104538291-104538313 CTGCTCAAAAAAATAATTTTAGG + Intergenic
1012862307 6:104574317-104574339 CTACTCAAATTCAGAGTTCTTGG - Intergenic
1014807096 6:125841736-125841758 TTGCTCAAAAACAGAATTTCTGG - Intronic
1017147008 6:151243539-151243561 ATGCACTAAAGCAGAAGTCTTGG + Intronic
1019183767 6:170209093-170209115 CACCTCAGAAGCTGAATTCTCGG + Intergenic
1019671012 7:2278341-2278363 CTGCTCAAAAGCTGGAGCCTTGG + Intronic
1021789631 7:24191646-24191668 CTGCCCAAAATGAGAATTCCAGG - Intergenic
1021967105 7:25930593-25930615 AATCCCAAAAGCAGAATTCTGGG + Intergenic
1022641349 7:32186952-32186974 TTTCTAAAAAGCAGAATTCAAGG - Intronic
1023054084 7:36278050-36278072 CTGTTAAAATGCAGACTTCTAGG + Intronic
1024162101 7:46687197-46687219 ATACCCAACAGCAGAATTCTTGG - Intronic
1024267058 7:47614841-47614863 CTTCTCAAAGGCAGAGATCTTGG - Intergenic
1024631300 7:51249677-51249699 CTGATCAACAGAAGAATTGTAGG - Intronic
1026039880 7:66859393-66859415 CTGCTTCTCAGCAGAATTCTAGG + Intergenic
1026385881 7:69847311-69847333 CTCCTCAAAGGCAGAATGCTAGG - Intronic
1029353116 7:100029668-100029690 CTGCTCAAGAGTAGAGGTCTTGG + Intronic
1029802598 7:102964916-102964938 CTGGACAAAAGCTGAATTCAGGG + Intronic
1029887513 7:103888744-103888766 CTGCACCAAAGCAGAAGACTTGG + Intronic
1030514302 7:110520772-110520794 ATGCTGCAAAGAAGAATTCTAGG + Intergenic
1032525076 7:132573858-132573880 CTGCTGAAAAGAAGCATTCATGG + Intronic
1033904421 7:146184135-146184157 ATGCTCAAAAGCAAAAATCACGG + Intronic
1033948886 7:146759256-146759278 CTGGTGAAATACAGAATTCTTGG + Intronic
1033960178 7:146904769-146904791 ATGCTCAAAAGATGAATTCTCGG - Intronic
1034237668 7:149585296-149585318 CTGGGGAAAAGCAGGATTCTGGG + Intergenic
1034240749 7:149608955-149608977 CTGGGGAAAAGCAGGATTCTGGG + Intergenic
1038098849 8:24349041-24349063 CACATCAGAAGCAGAATTCTAGG - Intronic
1039319991 8:36419123-36419145 CTCCACAAAAGCATAATGCTGGG - Intergenic
1044322802 8:90823539-90823561 CTGCTGAAATGCAGATTCCTAGG - Intronic
1045140204 8:99272001-99272023 CTTGTTAAATGCAGAATTCTGGG + Intronic
1045445137 8:102254302-102254324 CTACACAAAACCAAAATTCTTGG + Exonic
1047351166 8:124075961-124075983 CTGCTAAAAAGAAAAATTATTGG - Intronic
1047947591 8:129897601-129897623 CTACTCAGAAGCTAAATTCTTGG - Intronic
1050141779 9:2523598-2523620 CTGCTTAGAACCAGAATTTTTGG - Intergenic
1051417928 9:16862147-16862169 ATGCTCAAGAGTAGAATTGTTGG - Intronic
1051601194 9:18876610-18876632 CTGATTAACAGCAGATTTCTTGG - Intronic
1056998156 9:91483348-91483370 CTGCTCAAAATCAGAAAGCCTGG + Intergenic
1057577342 9:96253874-96253896 CAGAACAAAAGCAGAATTCATGG + Intronic
1057879982 9:98785980-98786002 CATCTCAAAAAAAGAATTCTGGG - Intronic
1060133363 9:121127330-121127352 ATGCTCAGAAGCAGAACTGTGGG + Intronic
1186304713 X:8243481-8243503 CTGTTCAAAAGAAGAACTATAGG - Intergenic
1186606243 X:11095568-11095590 TTGTTCAAAAGCAGATTGCTGGG + Intergenic
1187153062 X:16698849-16698871 CTGCTCAAAAGTAGAACTGAAGG - Intronic
1187542006 X:20206047-20206069 CTGAGCAGAAGCAGAATACTGGG - Intronic
1187878539 X:23824772-23824794 CTGCTCAAAAGCCCAATTCTGGG + Intergenic
1187990912 X:24871258-24871280 CTGCTCAAACACAGATTGCTGGG + Intronic
1189066956 X:37820213-37820235 CTGCTAAAAAGCAAAGTTCCAGG + Intronic
1194306230 X:92253100-92253122 CTGCACAAAAGCAATACTCTTGG + Intronic
1195994391 X:110717169-110717191 CTGCTTAAATGCAGATTCCTGGG + Intronic
1201305590 Y:12547298-12547320 TAGCTCAAAAGCAGAGTTCCTGG - Intergenic
1202137274 Y:21679092-21679114 TAGCTCAAAAGCAGAATTGATGG + Intergenic
1202602384 Y:26607101-26607123 CTTCTCAAAAGAAGAAATTTAGG + Intergenic