ID: 1157796641

View in Genome Browser
Species Human (GRCh38)
Location 18:50580979-50581001
Sequence CTGGGTAAGCAGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 369}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157796641_1157796648 26 Left 1157796641 18:50580979-50581001 CCTTCCACCTTCTGCTTACCCAG 0: 1
1: 0
2: 4
3: 45
4: 369
Right 1157796648 18:50581028-50581050 CCTCACTCTGTGAGCACTGAAGG 0: 1
1: 0
2: 2
3: 18
4: 183
1157796641_1157796649 29 Left 1157796641 18:50580979-50581001 CCTTCCACCTTCTGCTTACCCAG 0: 1
1: 0
2: 4
3: 45
4: 369
Right 1157796649 18:50581031-50581053 CACTCTGTGAGCACTGAAGGAGG 0: 1
1: 0
2: 1
3: 21
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157796641 Original CRISPR CTGGGTAAGCAGAAGGTGGA AGG (reversed) Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900603172 1:3511855-3511877 CTTGGTGAGCAGAGGGTCGAGGG - Intronic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902386528 1:16079100-16079122 CTGGGTCAGCAGACGGCGGGAGG - Intergenic
902696520 1:18144200-18144222 CTGGGGAAGGAGAAGATGGGAGG - Intronic
903614101 1:24639657-24639679 ATGGGAAACCAGAAGGTTGAAGG + Intronic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
905473494 1:38209814-38209836 CTGGGGATGCAGAAGCTGGCGGG + Intergenic
905689454 1:39932261-39932283 CTAGGTGAGGAGAAGATGGAAGG + Intergenic
906433119 1:45772228-45772250 CTTGGGAAGCCCAAGGTGGATGG - Intergenic
906814872 1:48868326-48868348 CTGCTTAAGCAGAAAGGGGAAGG + Intronic
907236799 1:53056824-53056846 TTGGGGAGGCAGAAGGTGGGAGG - Intergenic
907414803 1:54306940-54306962 CAAGGTAAGCAGTAGTTGGAGGG - Intronic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
908466711 1:64403099-64403121 CTGCGGAGGCAGAAGATGGAGGG + Intergenic
911110989 1:94185111-94185133 CTGGGCAAACTGCAGGTGGAAGG + Intronic
911971238 1:104440516-104440538 CTGGGTAAAAAGCAAGTGGATGG - Intergenic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
913544483 1:119853720-119853742 CTGGGAACGCTGAAGGTGGGAGG - Intergenic
913602316 1:120433658-120433680 CTGGGAACGCTGAAGGTGGGAGG + Intergenic
914084730 1:144442979-144443001 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914190742 1:145408145-145408167 CTGGGAACGCTGAAGGTGGGAGG - Intergenic
914363490 1:146957264-146957286 CTGGGAACGCTGAAGGTGGGAGG + Intronic
914488187 1:148129870-148129892 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914588551 1:149084990-149085012 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914847900 1:151292919-151292941 CTGGTGGAGCAGATGGTGGATGG - Exonic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
916260168 1:162833991-162834013 GAGGGTAAGCAGGAGGTGGCAGG + Intronic
917124071 1:171670521-171670543 CTGGGAACGCCGAAGGTGGGAGG + Intergenic
918765162 1:188472587-188472609 ATGTGTAAGCAGAGGGTTGAAGG + Intergenic
918922041 1:190725148-190725170 CTGTGTCCTCAGAAGGTGGAAGG + Intergenic
920540728 1:206776042-206776064 CTGGGAAATCAGAAGGTTGTGGG + Intergenic
921686790 1:218098499-218098521 CACGGTAAGCAGAAGTCGGAGGG - Intergenic
921977885 1:221222221-221222243 GTGGGGAAGCAGAATGTGTAGGG + Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922789493 1:228303362-228303384 CTGGGTAGGCAGAGGTAGGAAGG - Intronic
923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG + Intronic
923806028 1:237258956-237258978 CTGGCCAAGCAGAAGGCAGAAGG - Intronic
924587864 1:245375746-245375768 CTTGGTAAGGAGAAGCGGGATGG + Intronic
1062940218 10:1415185-1415207 GTGGGTGAACAGATGGTGGATGG + Intronic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063556088 10:7081137-7081159 CTGGGTAGGCAAAAGCTGCAGGG - Intergenic
1064205378 10:13319593-13319615 CTGGGAAAGCTGAAGTGGGAGGG - Intronic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1066366300 10:34780036-34780058 CGGGGAAAGAAGAAGATGGAGGG - Intronic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1069547800 10:69341235-69341257 CTGGGGAAGCAGAGGTTGCAGGG - Intronic
1069623138 10:69850080-69850102 CTGGGTGAGCTGGAGGTGGAGGG + Intronic
1069625425 10:69864975-69864997 CTGAGGAAGCAGCAGGTGCATGG + Intronic
1069870461 10:71529805-71529827 GTGGGTAAGGAGGAGGTGGGAGG - Intronic
1070660252 10:78300585-78300607 CTGGGGAAACAGAAAGTGAAGGG - Intergenic
1071880526 10:89892186-89892208 GTGGGTAAGCAGAAGGGAGAAGG - Intergenic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072497457 10:95976248-95976270 ATGGGTGAGCAGAAAGTGGAGGG - Intronic
1072540411 10:96394202-96394224 CTGGGCAAGCACAAGTTGTAGGG + Intronic
1072631730 10:97151236-97151258 GTGGGTGAGTAGAAGATGGAAGG + Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1074904260 10:117847186-117847208 CTTGGGAAGAAGAATGTGGATGG + Intergenic
1075489486 10:122854411-122854433 CTTGGGAAGCAGGAGATGGAGGG - Intronic
1075874611 10:125796037-125796059 GTGGGGAAGCAGAGGGTGAAGGG - Intronic
1076091087 10:127686281-127686303 CTTGGAAAGCAGAAGGTGGGTGG + Intergenic
1077015139 11:395995-396017 GTGGGTGGGCAGAGGGTGGAGGG - Intronic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1078200105 11:9173595-9173617 TTTGGTAAGCTGAAGGGGGAGGG - Intronic
1079104922 11:17564437-17564459 CTGGGTAAGGAGAGGGAGGGAGG + Intronic
1081121850 11:39276463-39276485 CTGGGCTACCAGAAGCTGGAAGG - Intergenic
1083399128 11:62411809-62411831 CTGGGGAAGCAGGAGTGGGAAGG - Intronic
1083746964 11:64742222-64742244 CTGGGCAAGCAGGAGGTGGGCGG - Intronic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1084601353 11:70147616-70147638 TTGGGAAATCAGAAGGTGGGAGG + Intronic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1087235850 11:95717909-95717931 CTGGGTGAATAGAAGGTAGATGG - Intergenic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1089129171 11:116198948-116198970 CTGGGTAGAAAGAAGTTGGAGGG + Intergenic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1089705900 11:120277379-120277401 CAGGGTTAGAAGGAGGTGGAGGG - Intronic
1089786021 11:120907835-120907857 CTGGGCAAGCAAAAGGTAGAAGG + Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090936076 11:131343748-131343770 CTGAGTAAAGAGAAGTTGGAAGG + Intergenic
1091449676 12:564733-564755 CTGGGCATGCTGAAGGTTGAGGG - Intronic
1094084737 12:26577014-26577036 GGGGGAAGGCAGAAGGTGGAAGG - Intronic
1096046663 12:48568466-48568488 TGGGGTAAGGAGAAGGAGGATGG + Intronic
1096116894 12:49060249-49060271 CGGGGGGAGCAGAAGGTGGGGGG - Intergenic
1097240962 12:57575003-57575025 ATGGGTAGGTAGAAGGTGGGAGG + Intronic
1098739537 12:74154951-74154973 CTGGGGAAGCTGAAGTGGGAGGG - Intergenic
1099637514 12:85233292-85233314 CTAGATAAGCAGAAGGAGAATGG + Intronic
1100024161 12:90107365-90107387 CTGGGAAAGTAGAGGGTGGGAGG + Intergenic
1100102574 12:91126706-91126728 CTGGGCAAACAGAAGAGGGAGGG + Intergenic
1102034281 12:109761954-109761976 CTGGGGAAGCAGTTGGTGCAGGG - Intronic
1102650779 12:114440872-114440894 CACGGAAAGCAGAAGGCGGAAGG + Intergenic
1102959860 12:117085414-117085436 TCGGGAAGGCAGAAGGTGGAAGG + Intronic
1103013899 12:117479311-117479333 CTGGGAGTGCAGGAGGTGGATGG - Intronic
1105212219 13:18263674-18263696 CTGTCTAACCACAAGGTGGAAGG - Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1112111881 13:96310393-96310415 TTGGGTTTGCAGAAGGTGGAAGG + Intronic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1112776979 13:102854976-102854998 CTGGGAAAGGAAGAGGTGGAGGG - Intronic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1113432447 13:110262318-110262340 CTGGGAAGGCTGATGGTGGAGGG - Intronic
1113960140 13:114121647-114121669 CTGGGGAAGCCGAAGGTCAAAGG - Intronic
1114906408 14:27133272-27133294 GAGGGTAAGGAGAAGGGGGATGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG + Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1120280463 14:82431747-82431769 ATGGGAAGGCAGAAGGGGGATGG + Intergenic
1121885855 14:97542174-97542196 GTGTGTTAGCAGAAGCTGGAGGG - Intergenic
1122100945 14:99409117-99409139 CTGGGCGAGGAGGAGGTGGAAGG - Intronic
1122218191 14:100218216-100218238 CTTGGCAAGCAGAAGGGGCACGG - Intergenic
1124096006 15:26649339-26649361 CTGGGTCATCACATGGTGGAGGG - Intronic
1124431818 15:29614735-29614757 CTGGGAAGGTAGAAGGTGGCAGG + Intergenic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125400722 15:39299779-39299801 TTGGGGAAGCAGAGGGTGGGGGG + Intergenic
1126386567 15:48099579-48099601 ATGGGTAGGCAGAAGGAGAAGGG - Intergenic
1128502546 15:68237377-68237399 CTGAGGAAGCTGAAGCTGGAGGG + Intronic
1129114778 15:73359208-73359230 CTGGGGGAGCAGTGGGTGGAGGG + Intronic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130430447 15:83842050-83842072 ATGGGAAGGCAGAAGGGGGATGG - Intronic
1130652069 15:85767888-85767910 CTGGGTGGGCAGCAGGTGGCTGG - Intronic
1130822309 15:87508516-87508538 CTAGGAAATCAGGAGGTGGAAGG + Intergenic
1131040922 15:89266102-89266124 CTTGGGAAGCAGAGGCTGGAGGG - Intronic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1131852179 15:96555035-96555057 CTGGGTAGGCAGAAAATGGTGGG - Intergenic
1131967358 15:97858622-97858644 GTGGCTCAGCAGAAGGTGAAAGG - Intergenic
1132097237 15:98996727-98996749 CTGGGCAAGCAGAAGGTAAAGGG - Intronic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1133448050 16:5879276-5879298 GATGGTAAGCAGAAGCTGGAGGG + Intergenic
1133681181 16:8121645-8121667 CTGGGAACCCAGGAGGTGGAGGG - Intergenic
1134868225 16:17628147-17628169 CTGGGTGAGGAAAAGGAGGAAGG - Intergenic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138509975 16:57503102-57503124 CTGGGTAAGGTGAAGACGGAAGG + Intergenic
1139620655 16:68138568-68138590 ATGGGAAAGAAGAAGGTGTATGG + Intronic
1141131673 16:81441692-81441714 CTGGGATAGTGGAAGGTGGAGGG + Intergenic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1142610781 17:1108460-1108482 CTGGGTCAGCTGAAGGGGGGAGG - Intronic
1143173950 17:4945906-4945928 CTGGGAACGCCGAAGGTGGGAGG + Exonic
1143363101 17:6387385-6387407 CTGGGTGAGAAGAAGATGAATGG - Intergenic
1143487400 17:7262344-7262366 CTAGGCAAACAAAAGGTGGAGGG + Exonic
1143722008 17:8819023-8819045 CTGGGACAGCAGTAGGTGGCTGG - Intronic
1144959536 17:19037329-19037351 CTGGGTATGCAGAAGTTGCCTGG + Intronic
1144975623 17:19137195-19137217 CTGGGTATGCAGAAGTTGCCTGG - Intronic
1145014539 17:19387671-19387693 CTGGGGGAGCAGAAGGCTGAGGG + Intergenic
1146533589 17:33631056-33631078 CTGGGTAAGGAGCAAGTGGAAGG + Intronic
1147542199 17:41369725-41369747 CTGGGCAGGCAGAAGTTGTAGGG + Exonic
1147545412 17:41397514-41397536 CTGGGCAGGCAGAAGTTGTAGGG + Exonic
1147878137 17:43636213-43636235 CTGGGTAAGCCCATGGTGGGTGG - Intergenic
1149688047 17:58549781-58549803 CAGGGTAAGCTGTTGGTGGAAGG + Intergenic
1151160781 17:72163702-72163724 CAGGATAAGCTGAAGGTGGGTGG - Intergenic
1151268251 17:72973257-72973279 CTGGGTCAGCAGAAGGACCAGGG + Intronic
1151475629 17:74343001-74343023 CTGGGGCAGAACAAGGTGGAGGG - Intronic
1151728553 17:75897991-75898013 CTGGCTAACTAGTAGGTGGAGGG - Intergenic
1151875702 17:76867185-76867207 CTGGCTAAGGAGATGTTGGAGGG - Intergenic
1152447267 17:80353081-80353103 CTGGGGGAGCAGGTGGTGGAAGG + Intronic
1152643225 17:81457769-81457791 CTGGGTAATCAGGAGGGGGAGGG + Intronic
1152643250 17:81457830-81457852 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152643321 17:81458010-81458032 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1155041506 18:22069118-22069140 ATGTGTAAGCAGAAGCTGTAGGG - Intergenic
1155382129 18:25235373-25235395 CTGGGGAAGCAGAAGGTAAAGGG + Intronic
1156194742 18:34761465-34761487 ATGGGTAGGGAAAAGGTGGAAGG + Intronic
1157293704 18:46427144-46427166 CTGGGGATGGAGATGGTGGAGGG + Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158318415 18:56237379-56237401 CTGGGTTTGAAGAAGGAGGAAGG + Intergenic
1158702169 18:59758012-59758034 CTGGGTGAGGAGAAGGTTGGAGG - Intergenic
1160185406 18:76672786-76672808 CTGCGTCAGCACATGGTGGAAGG - Intergenic
1160203056 18:76810894-76810916 ATAGCTAAGGAGAAGGTGGAAGG - Intronic
1161283966 19:3459444-3459466 CTGGGTAAACCGAGGGTGGGGGG + Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162220661 19:9173540-9173562 ATGGGTGAGCCCAAGGTGGAAGG + Intergenic
1162973199 19:14193477-14193499 CTGGGAAGGCTGAAGGGGGAGGG + Intronic
1163939205 19:20477238-20477260 CTGGGTATGCACCAGGTGAAAGG + Intergenic
1165742159 19:38210885-38210907 CAGGGGAAGAAGGAGGTGGATGG + Intergenic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166390609 19:42407043-42407065 CTGGGTGAGCAGGAGCTGGGAGG + Intronic
1166560474 19:43729436-43729458 CTGGGCCAGCAGGAGGTGGTAGG + Exonic
1166646113 19:44533019-44533041 CTGGCTTAGGAGAAGGTGGGTGG - Intergenic
1167294149 19:48639668-48639690 CTGGGGGAGGAGAAGGTTGAGGG - Intronic
1167474543 19:49692144-49692166 CTGGGTATGAAGGAGGAGGAGGG + Intronic
1167781221 19:51600696-51600718 CTTGGTATACAGTAGGTGGATGG + Intergenic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
925038319 2:709287-709309 CCGGGGAAGAAGAAGGTGGAAGG - Intergenic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925615506 2:5741074-5741096 CTGCGGAAGCAGAGGATGGAAGG - Intergenic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
926361704 2:12094152-12094174 ATGGTTTAGCAGAAGGTGCAGGG + Intergenic
927069030 2:19506160-19506182 CTGGGAAAGCTGAACGTGTATGG + Intergenic
927826233 2:26311908-26311930 TTGGGTAAGCTGAAGGCGAAGGG + Exonic
928411671 2:31059112-31059134 CTGTTTAAGCACAAGTTGGAGGG + Intronic
928418929 2:31122225-31122247 CGGGATAAGCAGAACGTGAAGGG + Intronic
929131496 2:38578692-38578714 TTGGGTAAGCAGAAGCTAAATGG - Intronic
929318763 2:40514289-40514311 CTGGGAAGGAAAAAGGTGGAAGG - Intronic
929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG + Intergenic
930196123 2:48512205-48512227 CTGGGCAAGCAGAAGGATTATGG - Intronic
931393517 2:61865272-61865294 CTGAGTAAGAAAAAGGTGGCTGG + Intergenic
931765595 2:65453269-65453291 CTGGGAAGGAAGAAGGTAGAAGG + Intergenic
931778028 2:65556677-65556699 TTGCGGAAGCAGGAGGTGGATGG + Intergenic
933543676 2:83681431-83681453 CTGGGTAATCAGATACTGGAAGG - Intergenic
934794691 2:97090594-97090616 CGGGGTAACCAGAAGGGGAAAGG - Intronic
934927425 2:98391344-98391366 CTGAGCAAGCAGCAGGTGGGCGG + Intronic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
935317536 2:101850698-101850720 GTTGGTATGCAGAAGGTGGCTGG + Intronic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
938923883 2:136021107-136021129 CTGGGTCAAGAGAATGTGGATGG + Intergenic
939831456 2:147077169-147077191 CTGGGTTTGCACAAGGTTGAAGG + Intergenic
940210431 2:151251219-151251241 CTGAGTCAGGAGAAAGTGGATGG - Exonic
940442062 2:153727886-153727908 GTGGGTAAGGGGAAAGTGGAGGG - Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940757426 2:157699228-157699250 CTGGGTCAGAAGAAGGAGCAGGG + Intergenic
941372864 2:164688793-164688815 TTGGTTCAACAGAAGGTGGAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942455621 2:176136574-176136596 CTGGGAAAGCAGAATGCGGGGGG - Intergenic
943129887 2:183841720-183841742 CTGGGGAAGCAGAAGCAGGGTGG + Intergenic
944911122 2:204311359-204311381 CTGGGTGAGCAGCAGGTCTAGGG - Intergenic
945524761 2:210874463-210874485 CTGTGTTATCAGATGGTGGAAGG + Intergenic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
947746124 2:232508210-232508232 CTGGGTAGGCTGAGGGAGGAGGG + Intergenic
947815623 2:233034488-233034510 CTGAGGAAGCAGAAGGCAGAGGG - Exonic
947909705 2:233792953-233792975 CTGGGTAAGGAGCAGATGGAGGG + Intronic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948948668 2:241235102-241235124 CCGGGTGAGCAGGAGGTGGCCGG - Exonic
1168999032 20:2153559-2153581 CTGGGTAAACACTAGTTGGAGGG - Intronic
1169214103 20:3783910-3783932 CTGGGAAAGGAGCAGCTGGACGG + Exonic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1171478636 20:25434885-25434907 CTTGCATAGCAGAAGGTGGAAGG + Intronic
1174454893 20:50642004-50642026 CTGCGGAAGCAGAAGGGGGTGGG - Intronic
1174471909 20:50767726-50767748 CTGCGGAAGCAGAAGGGGGTGGG + Intergenic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1175522378 20:59610177-59610199 CTGGGGAAGCAGAGGTTGCATGG + Intronic
1175774147 20:61642307-61642329 ATGGGGAACCAGCAGGTGGATGG + Intronic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1175956022 20:62609861-62609883 CCAGGTAAACAGAAGCTGGAAGG + Intergenic
1178477192 21:32947295-32947317 CTAGGTAAGCAGAAAGGGGCTGG + Intergenic
1180003562 21:45007607-45007629 CTCGGAGAGCAGAAGGGGGATGG - Intergenic
1181539413 22:23565512-23565534 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1181678255 22:24472089-24472111 CTGGGTAGGCAGAAGGCCTAGGG - Intergenic
1183096102 22:35553212-35553234 CTGTGTGTGCAGAAGGTGGTGGG - Exonic
1183579494 22:38715424-38715446 CTGGGCCTGCAGAAGGAGGAAGG - Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183786883 22:40034480-40034502 CTGGGAGAGCAGAAGCTGCAAGG - Exonic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185376585 22:50485419-50485441 CTGGGTCAGGAGAAGGTGTCTGG - Exonic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
951570970 3:24062880-24062902 CTGCCTAAGCAGAAGTTGAAAGG + Intergenic
952055469 3:29439750-29439772 CTGGGTAAGAAAAAGGGGGGAGG - Intronic
952436947 3:33280975-33280997 ATTGGGAAGCAGAAGATGGAGGG + Intronic
953445051 3:42956315-42956337 CTGTGTACTCAGAAAGTGGAAGG + Intronic
955113875 3:55976980-55977002 CTGTGTGAGAACAAGGTGGAAGG - Intronic
957890320 3:86348788-86348810 GTGGGTAGTCAGAGGGTGGAAGG - Intergenic
958188406 3:90153119-90153141 CTAGGGAAGCAGAAGCTGAAAGG + Intergenic
959496762 3:107060866-107060888 CTAGGTAAAAAGAAGGTGAAAGG - Intergenic
959750078 3:109824006-109824028 GTGGGTAAGCAAGAGGTTGATGG - Intergenic
959933194 3:112004199-112004221 CTTGGAAAACAGAAGGTGAATGG + Intronic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
961037780 3:123654661-123654683 GGGGGTTAGGAGAAGGTGGAGGG - Intronic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
962417525 3:135196720-135196742 GTGGGAAAGGAGAAGTTGGAGGG - Intronic
962536099 3:136329829-136329851 CAGGCTGAGCAGAAGGTTGAGGG + Intronic
963507613 3:146206720-146206742 CTGGGTAGCCAGTAGGTGGAGGG + Exonic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
967037008 3:185655508-185655530 CTGGGGAAGTAGAAGGTTGCTGG + Intronic
967218496 3:187229741-187229763 CTAGGTAGGGAGAAGGTGGAAGG - Intronic
967808184 3:193733343-193733365 CTGGGTAGGGAGCAGGTGCAGGG + Intergenic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
968614233 4:1570167-1570189 CTGGGTAGGAAGAGGGTGCAAGG + Intergenic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
969081769 4:4624640-4624662 CTGGGAAGGCAGAAGGTGAAAGG + Intergenic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
969883684 4:10196638-10196660 CTCTGTCAGCAGAAGGTGGGGGG + Intergenic
970007031 4:11421345-11421367 CTGGGTAGGAAGGAGGGGGAGGG - Intronic
970451064 4:16166865-16166887 ATGGCTAAGGAGAAGGTGGGGGG + Intronic
972806004 4:42529959-42529981 CTGGGGAAGAAGTATGTGGATGG + Intronic
977914531 4:102577001-102577023 ATTTGCAAGCAGAAGGTGGAGGG + Exonic
979518460 4:121638745-121638767 CTGGGCAAGCAGCAGGAGGCTGG - Intergenic
979996304 4:127435548-127435570 CTGGGGAAGCAGAGGTTGGGAGG + Intergenic
980985693 4:139692300-139692322 CTGGGTGAGCAGCAGGTGGCTGG - Intronic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
984520533 4:180796374-180796396 ATGGGTAACTAGAAGGGGGATGG + Intergenic
985112584 4:186561199-186561221 CTGGGTACTCAGGAGGTTGAGGG + Intergenic
985913450 5:2900533-2900555 CTGGGGAGGGAGAAAGTGGAGGG - Intergenic
986602069 5:9482460-9482482 CTGGGTGAGTGGAAGGTGGGAGG + Intronic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
988893546 5:35647249-35647271 CTTAGTAAGGAGAAGGGGGAGGG + Intronic
989424079 5:41275521-41275543 CTGGGTATGCAGAAGTTTGCTGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
991131696 5:63130199-63130221 CTGGGTAAGCAGATATAGGATGG - Intergenic
992739934 5:79763276-79763298 CTTGGTGAGCAGAAGTTAGAGGG - Intronic
993492474 5:88568931-88568953 GTGGGTCGGCAGAAGGGGGAGGG + Intergenic
995507978 5:112880296-112880318 CTTGGTAATTAGAAAGTGGAAGG - Intronic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997749544 5:136330968-136330990 GTGGGTAAGCAGAGGGTTTATGG + Intronic
998552471 5:143090673-143090695 CTGGGTTAGCTGATGGGGGAGGG + Intronic
998565795 5:143214805-143214827 CTGGGTCAGCAGGAGTGGGAGGG + Intronic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
999275238 5:150325654-150325676 CTTGGTGTGCAGAGGGTGGAGGG - Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1003052250 6:2790620-2790642 CTGGGAGAGCAGGAGGTGGCCGG + Intergenic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1004361433 6:14974583-14974605 CTGGGTAAGCAGAATTTGATGGG + Intergenic
1005882544 6:30072082-30072104 CTGGGTCAGCAAAATGGGGAAGG + Intronic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1007474128 6:42107633-42107655 CTGGGTAAACAGAAATTGGCAGG - Intronic
1009603394 6:65833727-65833749 CCAGGTAAGCTGAAGCTGGAGGG - Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1010806587 6:80244191-80244213 CTGGTGAAGCAGGAGATGGAAGG + Intronic
1011125518 6:84003120-84003142 CTGGGTAAGCATCAGGTGATGGG + Intergenic
1012187181 6:96233395-96233417 CTGGATTAGAAGAAGGTAGATGG - Intergenic
1012366544 6:98447551-98447573 CTGGGTGAGGAGGAGGTAGAAGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013589172 6:111605842-111605864 CTGGGCCCGGAGAAGGTGGAGGG - Exonic
1014602724 6:123434941-123434963 CTGGGGAAGTTGTAGGTGGATGG - Intronic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016829204 6:148416941-148416963 CTGGGCAAGCAGCAGGTGATGGG + Intronic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018831984 6:167450248-167450270 ATGGGTAAGCAGAATGTTAATGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019372663 7:671087-671109 CTGAGGAAGAAGGAGGTGGACGG - Intronic
1021479918 7:21104556-21104578 CTGGGAAACTAGAAGGTGGTTGG + Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022989198 7:35691463-35691485 ATGGGTCAGGAGTAGGTGGAGGG - Intronic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1027345497 7:77255406-77255428 TTGGATTATCAGAAGGTGGAAGG - Intronic
1028879084 7:95859475-95859497 CTGGGTAAGATGAATGTGGAAGG - Intronic
1030115267 7:106058091-106058113 CTGCGTGGGCAGCAGGTGGAGGG + Intergenic
1030309277 7:108053355-108053377 CTGGGTAAACTACAGGTGGAAGG - Intronic
1031339424 7:120580430-120580452 CTTGTGGAGCAGAAGGTGGAAGG - Intronic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035303263 7:157911851-157911873 CAGGGTTAGCAGAAGACGGAAGG - Intronic
1036181360 8:6588194-6588216 CTGGACTAGGAGAAGGTGGAGGG - Intronic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1038375227 8:27033539-27033561 CTGGGTAAGAGGAAGCAGGATGG - Intergenic
1041705303 8:60840576-60840598 ATTGGGAAGCTGAAGGTGGAAGG - Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045331394 8:101158643-101158665 CTGTGTATGCAGATGATGGATGG + Intergenic
1045402785 8:101835342-101835364 CTGGTTTGGCAGAAGGTGGAGGG - Intronic
1046174683 8:110560050-110560072 ATGGGGAGCCAGAAGGTGGAGGG + Intergenic
1047966927 8:130051829-130051851 CAGGGCAAGAAGAGGGTGGAGGG - Intergenic
1048496745 8:134942011-134942033 CTGGGAAAGCAGGAGCTGGAGGG - Intergenic
1049770256 8:144376817-144376839 CTGGGTAGGCAGCAGGTGGATGG + Intronic
1050206774 9:3204695-3204717 CTGTGTCATCACAAGGTGGAAGG - Intergenic
1051299769 9:15636196-15636218 CTGGGTATGGAGTAGGTAGATGG + Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1052216813 9:25976050-25976072 AAGGGGAAGCAGAAGGTGAAGGG - Intergenic
1055467650 9:76581769-76581791 CTGGGTACTCAGAGGGTGGCTGG - Intergenic
1055792235 9:79935203-79935225 ATGGGTAAGCAAAAGGAGCAGGG + Intergenic
1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG + Intergenic
1056200758 9:84274080-84274102 CTGCATGACCAGAAGGTGGAAGG + Intergenic
1056236159 9:84596879-84596901 ATGGGTAAGTAGAAGCTAGAGGG - Intergenic
1056428663 9:86504847-86504869 CAAGGTGAGCAGAAGGTAGAGGG - Intergenic
1057364255 9:94404038-94404060 CTCACAAAGCAGAAGGTGGAAGG - Intronic
1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG + Intronic
1057659079 9:96984033-96984055 CTCACAAAGCAGAAGGTGGAAGG + Intronic
1058137671 9:101325375-101325397 ATGGGTAGGCTGAAGGTAGAGGG - Intergenic
1058585897 9:106505805-106505827 CTGGCTTTGCAGAAGGAGGAAGG - Intergenic
1059299158 9:113298728-113298750 CTGGGTGAGTAGGATGTGGAGGG - Exonic
1060942154 9:127548984-127549006 GTGTGTAAGCAGAGGCTGGAGGG + Intronic
1061275555 9:129568018-129568040 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1061607843 9:131724900-131724922 ATGGGTAAGCACAAGGCAGATGG - Intronic
1061908682 9:133711711-133711733 CTGGGGAGGCAGTAGGTGGGTGG - Intronic
1185638963 X:1575827-1575849 ATGGGTAAGTAGAAAGTGGGTGG + Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1186844580 X:13517962-13517984 CTGGGTATGGAGAAAGTGGAAGG - Intergenic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1188450718 X:30306259-30306281 TTGGGTGGGGAGAAGGTGGAGGG - Intronic
1188852034 X:35143930-35143952 CTGGGGAAGAAGCATGTGGATGG - Intergenic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1192016739 X:67339413-67339435 CTGGGGAAGCAGAAGAGAGAGGG + Intergenic
1192868704 X:75164257-75164279 GTTGGAAAGCAGAAGGTGAAAGG - Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1193040540 X:76999266-76999288 CAGGGTAAGCAGAAGTAGGGTGG - Intergenic
1193437787 X:81499648-81499670 CTGGCTATGCAAAAGGTGGAGGG + Intergenic
1194391013 X:93318068-93318090 CTAGGAAAGGAGAAAGTGGAAGG + Intergenic
1195292588 X:103443470-103443492 CTGTGTCATCACAAGGTGGAAGG - Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196047318 X:111269951-111269973 GTGGGTCAGCAGAAGCTAGAAGG + Intronic
1196486001 X:116207832-116207854 CTGGATAATCAGAAGTTGGGAGG + Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic