ID: 1157802981

View in Genome Browser
Species Human (GRCh38)
Location 18:50635912-50635934
Sequence AGGCCTAGTGGACCACACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157802981_1157802987 5 Left 1157802981 18:50635912-50635934 CCATGGTGTGGTCCACTAGGCCT 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1157802987 18:50635940-50635962 GCCTGGTCCACATGGTCACATGG 0: 1
1: 0
2: 2
3: 24
4: 215
1157802981_1157802986 -3 Left 1157802981 18:50635912-50635934 CCATGGTGTGGTCCACTAGGCCT 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1157802986 18:50635932-50635954 CCTTGATGGCCTGGTCCACATGG 0: 1
1: 0
2: 1
3: 7
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157802981 Original CRISPR AGGCCTAGTGGACCACACCA TGG (reversed) Intronic
900423612 1:2566438-2566460 AGGCCTTGTGCAGCAAACCAGGG + Intergenic
904002393 1:27346143-27346165 AGGCCCAGTGGACCATGCCTAGG - Intronic
914918525 1:151832557-151832579 AGACCTAGTGGCCCACACTGAGG + Intergenic
915846906 1:159276318-159276340 AGGACAAGTGGACCAAAACATGG + Intergenic
919842558 1:201619787-201619809 AGGCCTGGAGGGCCACACCCAGG - Intergenic
924245021 1:242075408-242075430 AGGCCTAGGGGTTTACACCACGG + Intergenic
924784854 1:247185225-247185247 AGGCCAAGTCGGCCACACCAGGG + Intergenic
1062992219 10:1831033-1831055 CAGCCCAGTGGACAACACCATGG + Intergenic
1067581111 10:47446608-47446630 AGGCCTAAGTGACCTCACCAAGG - Intergenic
1069728900 10:70598691-70598713 TGGCCTGGTGGACTACACCCTGG - Exonic
1076484701 10:130808531-130808553 ATGCCTCCTGGTCCACACCAAGG + Intergenic
1077444169 11:2582605-2582627 AGGCATGGTGGCCCAGACCATGG - Intronic
1078092922 11:8278418-8278440 AAGCCTGGGGGACCACACCTGGG + Intergenic
1078365537 11:10703434-10703456 AGGCATAGAGAACCAAACCAAGG + Intergenic
1078894209 11:15583763-15583785 AGGCCTAGCAGCCCACTCCAAGG - Intergenic
1084302544 11:68261025-68261047 AGGCCGAGCTGGCCACACCACGG + Intergenic
1086849964 11:91798091-91798113 AGGGCAAGTGGAACATACCAAGG - Intergenic
1089903094 11:122009297-122009319 GGGCCAACTGGACCACAACATGG - Intergenic
1090541944 11:127716080-127716102 AGGCCTTGTAGACCTCAGCAAGG - Intergenic
1091236584 11:134026228-134026250 AGTCCTAGAGGTCCACAGCAAGG + Intergenic
1092295217 12:7191570-7191592 AGGCCAAGTCTGCCACACCAGGG - Exonic
1092747528 12:11688059-11688081 AGGCCCAGGGTCCCACACCAGGG + Intronic
1095968955 12:47888333-47888355 AGGGCTAGTGGGTCACTCCATGG + Intronic
1097695456 12:62770797-62770819 AGGCCTGGTGGCCCACAGTAGGG + Intronic
1101987804 12:109461121-109461143 GGGCCTCGTGTACCACACCTGGG + Intronic
1102685511 12:114721419-114721441 AGGGCTTGGGGACCACGCCACGG - Intergenic
1103003336 12:117402745-117402767 AGGCCTAATGGAAGGCACCAGGG + Intronic
1104567168 12:129895501-129895523 AGGCCTTGTGGTCAAGACCAGGG - Intronic
1107361259 13:39619600-39619622 AGGGGTAGTGCACCACATCAAGG + Intergenic
1110610821 13:77485806-77485828 AGCCCTAGTGGCCCCCATCATGG - Intergenic
1129171806 15:73812467-73812489 AGGGCTAGTGGTCAACACCCGGG - Intergenic
1131551028 15:93357204-93357226 AGGCCTGGTGGTCCCCAGCAGGG + Intergenic
1132514356 16:359380-359402 AGGCCTACTTGACCACATCCTGG - Intergenic
1134689008 16:16178802-16178824 GGGCCTGGTGGACTACTCCAGGG - Exonic
1134769463 16:16794501-16794523 AGGCCAAGTGGTCTTCACCAAGG - Intergenic
1135963787 16:27019390-27019412 CGGCCTTGTGGCCCCCACCAAGG + Intergenic
1137573095 16:49579331-49579353 GGGCCAACTGGACCACACTAGGG + Intronic
1137599255 16:49744713-49744735 AGGTCAAGTGAACCGCACCAAGG + Intronic
1137954700 16:52817287-52817309 TGGCCAAGTGGACGAGACCAGGG + Intergenic
1138102627 16:54266001-54266023 AGGCCTTGTGGCTCACACCCAGG - Intronic
1140244785 16:73238362-73238384 AGGGCTCGTGGACCATCCCAAGG - Intergenic
1144276348 17:13672116-13672138 AGGGAGAGTGCACCACACCAAGG + Intergenic
1145278871 17:21454226-21454248 AGCCCCAGTGGACGGCACCAAGG - Intergenic
1147310088 17:39590586-39590608 AGGCCTGGATGCCCACACCAAGG + Intergenic
1150305995 17:64085785-64085807 GGGCCTAGCTGGCCACACCATGG - Intronic
1155558180 18:27045172-27045194 AGCCCTAGTGGACCAGAGAATGG - Intronic
1157802917 18:50635659-50635681 GGGCCTAGTGAACCAGACCACGG - Intronic
1157802981 18:50635912-50635934 AGGCCTAGTGGACCACACCATGG - Intronic
1160064588 18:75562844-75562866 TGGCCCAGTTGGCCACACCATGG - Intergenic
1163166649 19:15502682-15502704 AGGGATAGTGCAGCACACCAGGG - Intergenic
1167015659 19:46839399-46839421 AGGCCTTGGGGGCCACTCCAGGG + Intronic
934066376 2:88345740-88345762 AGGCCTTGTAGGCCACAGCAAGG - Intergenic
935124761 2:100213760-100213782 AGGCCTCTTGGACCTCAGCAGGG + Intergenic
935709727 2:105887484-105887506 AGGCCTGGTGAATCACACAAAGG + Intronic
939882099 2:147642405-147642427 AGGACTTTTGGACCACACCCAGG + Intergenic
947643354 2:231719950-231719972 AGGGCTACTGGACCAGACAAGGG - Intergenic
948032253 2:234828467-234828489 TGGCCTTGTGGACCCCACCCAGG - Intergenic
948506966 2:238434995-238435017 AGGCCCAGAGCACCAAACCAGGG - Intronic
1168941222 20:1712838-1712860 AGGGGGAGTGCACCACACCAAGG + Intergenic
1169358085 20:4924599-4924621 AGGTCTTGTGGGCCTCACCAGGG - Intronic
1170873681 20:20231603-20231625 AGGCCAAGTGCACCAGACAAGGG - Intronic
1171169149 20:23000117-23000139 AGGCCAAATGGACCACGACAGGG - Intergenic
1175768145 20:61605304-61605326 AGGCAGAGTGGGCCCCACCAAGG - Intronic
1176027011 20:62990919-62990941 AGGCCCACAGGACCACACAAGGG + Intergenic
1177243380 21:18490439-18490461 AAGCCTAGTGTACCACACAGAGG - Intergenic
1180885528 22:19240707-19240729 AGGCTTAGTGTACCACAAAAGGG + Intronic
1182082790 22:27541173-27541195 AGGCCTGCAGGACCCCACCACGG - Intergenic
1183019902 22:35018608-35018630 GGGCCTGATGGACCACAGCAAGG - Intergenic
1183760425 22:39811461-39811483 AGCCCTAGTGGTCCACTCCCAGG - Intronic
952768337 3:36974913-36974935 AGGCATAGTGGCTCACACCTGGG - Intergenic
952924124 3:38308923-38308945 AGGCCAAGAGGACAAAACCATGG - Intronic
954980513 3:54741193-54741215 AGGCCTAGAGGGACACACCCAGG + Intronic
959486280 3:106930368-106930390 AGGCCTACTGTACCACCACAAGG + Intergenic
959526523 3:107383676-107383698 GGCCCTAGTGGAGGACACCATGG + Intergenic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
962830331 3:139133698-139133720 AAGCTCAGTGGACCAGACCAGGG + Intronic
969204616 4:5634056-5634078 AAGCCTAGTGGATGACAGCAGGG + Intronic
973345121 4:49046971-49046993 AGTCCTAGGAGCCCACACCAGGG - Intronic
974011724 4:56613310-56613332 AGTCCTAGCAGACCACACCTTGG - Intergenic
978466330 4:109012896-109012918 TCGCCTAGTGGATCGCACCAGGG - Intronic
982654890 4:158135556-158135578 AGGGCTAGTTGACCTCCCCAAGG + Intronic
986587766 5:9336307-9336329 AGGGCTGGCGTACCACACCAGGG + Intronic
987266962 5:16265908-16265930 GGGCCTAGTTGACCTCAACAAGG - Intergenic
991415923 5:66392853-66392875 AGGCCTTGTGGACCTCAACTTGG + Intergenic
994104472 5:95931106-95931128 AGCCCTAATGGACCACATCTAGG + Intronic
1003413315 6:5885447-5885469 GGGCCTAGTGGACCACACTGAGG - Intergenic
1006086706 6:31600825-31600847 AGGGCGAGTGGACGACACCAAGG - Intergenic
1007913226 6:45536511-45536533 AGGGCTGTTGGACCACACCTGGG + Intronic
1019783488 7:2958771-2958793 TGGCAGAGTGGACCACACCAGGG + Intronic
1023543847 7:41296437-41296459 AGACCTATTGGTCCACACCCTGG - Intergenic
1029335192 7:99892890-99892912 AGGCCTAGCAGGCCACAGCATGG + Intronic
1029653327 7:101908651-101908673 AGGCCGACAGGACCAGACCATGG - Intronic
1032135090 7:129269265-129269287 AGGCATGGTGGTGCACACCATGG - Intronic
1033570441 7:142623139-142623161 GAGCCTAGTTGACCACACCCGGG - Intergenic
1034441696 7:151088905-151088927 AGGCCTAGTAGACGGAACCATGG - Intronic
1037911462 8:22746207-22746229 AGGCCCAGTGGAACAGAGCAAGG + Intronic
1038739282 8:30202686-30202708 AGGGTTAATGGACCAGACCAGGG + Intergenic
1041951783 8:63511075-63511097 AGGCATCGTGGAGCACACCATGG + Intergenic
1052350740 9:27456008-27456030 AGGCTTAGTGGACCTTTCCAAGG + Intronic
1056040306 9:82658895-82658917 GGGCATAGTGGCGCACACCATGG - Intergenic
1058751497 9:108042766-108042788 TGGCCTAGTTGCCCAAACCATGG + Intergenic
1061879835 9:133563038-133563060 CCGCCTGGTTGACCACACCATGG + Intronic
1186546723 X:10457708-10457730 AAGCCTCCTGGGCCACACCAGGG - Intronic
1187032012 X:15497891-15497913 AGTCCTAGGGGACCAGAACAGGG + Intronic
1187712856 X:22071719-22071741 AGGCATGGTTGTCCACACCATGG + Intronic
1188514867 X:30974355-30974377 AGGGCTAATGAACCACTCCAGGG - Intronic
1188790583 X:34404243-34404265 AGGGGTAGTGCACCACATCAAGG - Intergenic
1190797659 X:53759777-53759799 GGGCTTCCTGGACCACACCATGG - Intergenic
1190917491 X:54821392-54821414 GGGCTTCCTGGACCACACCATGG + Intergenic
1193614077 X:83666970-83666992 TGCCCTAGGGGTCCACACCATGG - Intergenic
1194875623 X:99184325-99184347 AGGCCTATTGCACAACTCCAGGG + Intergenic