ID: 1157808738

View in Genome Browser
Species Human (GRCh38)
Location 18:50678242-50678264
Sequence ATGGATTAATTAGGAAGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157808738 Original CRISPR ATGGATTAATTAGGAAGCAC TGG Intronic
900713610 1:4130201-4130223 AGGGAATAATTTGGAAGAACAGG - Intergenic
904919797 1:33998136-33998158 ATGGATTAATAGGCAAGCATGGG + Intronic
905748304 1:40438424-40438446 ATAGTTTATTTAGGAAACACAGG + Intergenic
907586432 1:55621832-55621854 AAGGATTAATTTGGGAGCAGAGG - Intergenic
907587112 1:55629884-55629906 ATGGAATAATTTGGAAGGACAGG - Intergenic
907881717 1:58555693-58555715 ATGAATTATTTAGTAAGTACTGG + Intergenic
908598500 1:65713008-65713030 ATGGAAAAATTAGAAAACACAGG - Intergenic
909369576 1:74868675-74868697 ATTGAATAATTAGTAAGTACTGG + Intergenic
909387834 1:75080158-75080180 ATGAAATAATTAGGAGGCCCTGG + Intergenic
910693816 1:89991559-89991581 AGAGATTAATTAGGAAGCTGAGG + Intergenic
910800058 1:91136324-91136346 ATGAGTTTATTAGGAAGAACTGG - Intergenic
911980849 1:104563578-104563600 ATTGATGAATTAGTAAGCAGTGG + Intergenic
916618481 1:166470457-166470479 ATGTAGTAATTAGGAAGTAATGG + Intergenic
917596794 1:176537397-176537419 AGGGACTAATTAGAAAGCATTGG - Intronic
917967639 1:180188408-180188430 ATGGATGAATTAAGGAGCTCTGG - Intronic
918097400 1:181346541-181346563 CTGAATTGATTAGGAAGAACAGG - Intergenic
921143318 1:212327079-212327101 CTGGAGTAATTACGAAGCATAGG + Intronic
924381290 1:243467180-243467202 ATTGATGAATCTGGAAGCACTGG + Intronic
1064891452 10:20179118-20179140 AGGAATTAAATAGGAGGCACTGG + Intronic
1065409623 10:25410244-25410266 AAGGATTAATTAGGAATCCATGG - Intronic
1065709680 10:28503472-28503494 TTTGATTAATTAGGAAATACTGG + Intergenic
1066061615 10:31728482-31728504 ATGGATAATTTAGGGAGCAGGGG - Intergenic
1066105165 10:32149801-32149823 ATGGATTCATGTGCAAGCACAGG - Intergenic
1066673393 10:37862968-37862990 ACGGAATAAATAGAAAGCACAGG - Intergenic
1066809044 10:39300987-39301009 ATTGATCAGTTTGGAAGCACTGG - Intergenic
1068397114 10:56477183-56477205 ATTAATTAATTTGGAAGCACAGG + Intergenic
1070270859 10:74953165-74953187 ATGAATTAATCAGGGAGTACAGG - Intronic
1071186730 10:83054731-83054753 ATTGGTACATTAGGAAGCACTGG - Intergenic
1071230781 10:83582161-83582183 ATGGATTAATGAGTTATCACAGG + Intergenic
1072171612 10:92868616-92868638 ATAAATTAATTAGGGAGAACAGG + Intronic
1072849970 10:98879532-98879554 ATGGATTTCTTAGGAATTACAGG + Intronic
1074469032 10:113710263-113710285 ATGGGATGGTTAGGAAGCACTGG + Intronic
1077628962 11:3797844-3797866 ATGGCTAGATTGGGAAGCACCGG + Intronic
1078739458 11:14052819-14052841 AAGAATTAAATAGGAAGTACAGG + Intronic
1080019614 11:27546311-27546333 ATGGATAAAATAAGAAGCATTGG - Intergenic
1085695913 11:78704570-78704592 ATGTATTAAGTAGAAAGAACAGG + Intronic
1085744042 11:79099624-79099646 AGGGATTGTTTAGGAAGGACTGG + Intronic
1085926023 11:81022039-81022061 ATGAATAATTTAGGAAACACTGG + Intergenic
1087704096 11:101469053-101469075 ATTGACAAATTAGGAGGCACTGG + Intronic
1089147127 11:116337237-116337259 ATGGAATAATTTGGAAACTCTGG + Intergenic
1090434533 11:126675828-126675850 ATGGATTAATGAGGAGAGACTGG + Intronic
1095074484 12:37899989-37900011 ATGGAACAATTCGGAAACACAGG - Intergenic
1096134375 12:49187516-49187538 ATGAATTAATTAAGATGCACTGG + Intronic
1097991443 12:65839077-65839099 ATGGCTTTGTTAGGAAGCAAGGG + Intronic
1103315489 12:120051451-120051473 AAGGACTCATTAGGAAGTACTGG - Intronic
1107704552 13:43087644-43087666 ATTCATGAATTCGGAAGCACTGG - Intronic
1109237130 13:59837477-59837499 ATGCACTAATTATGAAGCTCAGG - Intronic
1112391680 13:98990889-98990911 ATGGATTAATGAGTAAATACAGG - Intronic
1115296932 14:31838975-31838997 AAGTATTAATTAGGAAGAATAGG + Intronic
1116769172 14:49107271-49107293 ATAGATTAACTAGGATTCACAGG - Intergenic
1117500551 14:56346917-56346939 ATGGTTCAATTACGAAGCAAAGG - Intergenic
1124157000 15:27234793-27234815 ACGTAATAATTAGGAAGCAAAGG + Intronic
1124194519 15:27609700-27609722 ATTGAATAATTAGTAAGAACTGG - Intergenic
1138246538 16:55470885-55470907 ATGGATTAATTCCAAAGCACAGG - Intronic
1138789120 16:59881499-59881521 CTGGATTCATTAGGAAGCACAGG + Intergenic
1139850995 16:69951603-69951625 GTGGTTTAATGAGGAAGCCCTGG + Intronic
1139879977 16:70174515-70174537 GTGGTTTAATGAGGAAGCCCTGG + Intronic
1140203240 16:72911846-72911868 CTGGATTAAGTAGAAAGCAGAGG + Intronic
1140372537 16:74421012-74421034 GTGGTTTAATGAGGAAGCCCTGG - Intronic
1141288153 16:82691779-82691801 ATGGGTTAATAAGGAGGCACTGG + Intronic
1144056555 17:11547156-11547178 AAGGATGAATTAGGATGCAGAGG + Intronic
1146504987 17:33397079-33397101 AAGGATTATTAAGGAAGCACAGG + Intronic
1148399660 17:47345375-47345397 ATGGATAAATTAGTAAGTGCTGG + Intronic
1148443443 17:47723903-47723925 GGGGGTTAATTAGGAAGAACTGG + Intergenic
1148975386 17:51523149-51523171 ATGAATTAATTAGGGAGAATAGG - Intergenic
1149489395 17:57071567-57071589 AAGTCTTAATTAGGAAGCAAAGG + Intergenic
1150634096 17:66900595-66900617 CAGAATTAAATAGGAAGCACTGG - Intergenic
1153041313 18:814937-814959 AAGGATTAATTTGGAAGATCAGG + Intergenic
1155432778 18:25778668-25778690 AGGCATAAAGTAGGAAGCACTGG - Intergenic
1155716207 18:28946785-28946807 ATGTATAAATCAGTAAGCACAGG - Intergenic
1156753627 18:40493270-40493292 ATGGTATAACTGGGAAGCACAGG - Intergenic
1157808738 18:50678242-50678264 ATGGATTAATTAGGAAGCACTGG + Intronic
1158844553 18:61428167-61428189 AAGGATTACTTGGGAAACACAGG - Intronic
1167035326 19:46991864-46991886 AGGGATTAAGTAGAAAGAACTGG - Intronic
926418411 2:12673605-12673627 ATGGCTTAATTCAGAAGCAAAGG - Intergenic
926884943 2:17588376-17588398 ATGGAGTAACTAGGAAGGAAAGG + Intronic
929701217 2:44164648-44164670 ATGCATTAATAAAGAAGCATAGG - Intergenic
931633809 2:64324189-64324211 ATGGATTGATTTGAAAGCACTGG + Intergenic
933016146 2:77130151-77130173 ATAGATTTATTACAAAGCACTGG - Intronic
935218418 2:100992096-100992118 TTGGATCATTTAGGAAGAACAGG - Intronic
936442678 2:112568595-112568617 AGGGATCAACTGGGAAGCACAGG - Intronic
936485080 2:112918526-112918548 AGGGATTAATTAGATAGCACAGG - Intronic
939891562 2:147742983-147743005 ATGGAAGAATTTGGAGGCACAGG + Intergenic
942042388 2:172079370-172079392 ATGAAATAATTCGGATGCACTGG + Intronic
942426856 2:175869248-175869270 ATTTACTATTTAGGAAGCACAGG + Intergenic
943545228 2:189267900-189267922 ATGGATTGATAAAAAAGCACTGG - Intergenic
1170545401 20:17431728-17431750 ATGAATTCTTGAGGAAGCACTGG + Intronic
1174653250 20:52147711-52147733 ATGGAATAATAAGAAAACACAGG + Intronic
1175254349 20:57630126-57630148 ATGGATTAATCATGAAAAACAGG - Intergenic
1180857490 22:19057686-19057708 AGGGAACACTTAGGAAGCACTGG + Intronic
1181421953 22:22807179-22807201 ATGCATTCCTCAGGAAGCACAGG + Intronic
1182542289 22:31050386-31050408 ATGGCTTAATTAGGTAGTTCTGG + Intergenic
1184025526 22:41853048-41853070 ATGAACTAATTAAGAATCACTGG - Intronic
949268770 3:2190032-2190054 ATGGACTATTAAGAAAGCACAGG - Intronic
949410839 3:3762341-3762363 ATTAATTAATTAGGACCCACAGG + Intronic
949902750 3:8832530-8832552 ATAGATTAATTTGGAAGAATTGG - Intronic
950492590 3:13314980-13315002 ATGTAGTAATCAGGAAGCCCAGG - Intergenic
951745543 3:25973776-25973798 ATAGTTTATTTAGGAAGCACAGG + Intergenic
952129865 3:30349146-30349168 ATGGATTAGTTAAGGAGCTCAGG - Intergenic
952692071 3:36220825-36220847 ATGGCTAGATTAAGAAGCACTGG + Intergenic
952869606 3:37886525-37886547 AAGGCTTAGGTAGGAAGCACAGG + Intronic
955000423 3:54922385-54922407 GTGGATTAAATTGTAAGCACAGG - Intronic
955141132 3:56271134-56271156 ATGGATAAAGTGGGAACCACTGG - Intronic
956347323 3:68294951-68294973 ATGGTTATATTAGGCAGCACCGG + Intronic
958158820 3:89790169-89790191 ATGGTATAATTATGAAGAACAGG + Intergenic
959481438 3:106877223-106877245 ATCGATCAATTAAGAAGCAGTGG + Intergenic
960439056 3:117664436-117664458 AGGGGTTAATTATGATGCACAGG - Intergenic
960595693 3:119406030-119406052 ATGGATTCAATTGGAATCACTGG + Intronic
962086418 3:132196468-132196490 ATGGGTTAGTTGGGTAGCACTGG - Intronic
962399723 3:135048075-135048097 ATGGCTCAAAAAGGAAGCACAGG + Intronic
963222970 3:142831258-142831280 ATGGATTAATGGGCAATCACGGG + Intronic
963390426 3:144656558-144656580 ATGAATTGAGTAGGAAGCATTGG + Intergenic
963963976 3:151344639-151344661 ATGCAAAAATTAGGAAGTACTGG + Intronic
964041283 3:152265234-152265256 AAATATTGATTAGGAAGCACAGG + Intronic
964195256 3:154056863-154056885 AGGCATTAAACAGGAAGCACTGG + Intergenic
974343695 4:60649641-60649663 AAGGATAATTTAGGGAGCACAGG - Intergenic
975999999 4:80362957-80362979 ATTGTTTAATTTAGAAGCACTGG + Intronic
978254991 4:106682301-106682323 AGGGATGAAATATGAAGCACAGG - Intergenic
978361429 4:107934313-107934335 ATGGATTGATTAGAAGGGACTGG - Intronic
978425097 4:108573695-108573717 ATGGATGAATCAGACAGCACAGG + Intergenic
979657942 4:123218996-123219018 ATGAGTTTATTAGGGAGCACTGG + Intronic
981024100 4:140058773-140058795 AAGGATTAATTCAGAAGAACAGG - Intronic
982402949 4:154988588-154988610 CTGGATTCATTATGAGGCACTGG + Intergenic
982748280 4:159128635-159128657 ATGGATTATTTTAGAAGTACAGG + Intronic
984930575 4:184843739-184843761 CTGGATTAATTAGTGACCACTGG + Intergenic
985191985 4:187384380-187384402 AGGGATGAATTTTGAAGCACAGG - Intergenic
987914118 5:24189475-24189497 ATGTATTAATTATTAATCACTGG - Intergenic
988174526 5:27704416-27704438 ATGGTTACATTAGGAAGCATTGG + Intergenic
989835836 5:45989476-45989498 ATGGAGCATTTTGGAAGCACTGG + Intergenic
989839116 5:46038135-46038157 ATGGATCAGTTTGGAAACACTGG + Intergenic
991272959 5:64807712-64807734 AGTGAGTAATAAGGAAGCACTGG - Intronic
992530557 5:77647874-77647896 ATGTATTAGTTAGGATACACAGG + Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
993575907 5:89600576-89600598 ATGGACGCATTAGTAAGCACAGG + Intergenic
1000311517 5:160049715-160049737 AAGGATTATTTAGGACTCACTGG - Intronic
1000989461 5:167897114-167897136 GTGGATTAATCAGGAAGCGAGGG - Intronic
1001293393 5:170482220-170482242 ATTTATTATTTAGGCAGCACAGG + Intronic
1002530771 5:179843385-179843407 ATGGACTGAATTGGAAGCACAGG + Intronic
1004691784 6:17998428-17998450 ATGCCTTAATCAGGAATCACTGG - Intergenic
1004726341 6:18314685-18314707 TTGGATTAACTAGGGAGCAATGG + Intergenic
1008442305 6:51545556-51545578 AGGCATTAATGAGGGAGCACTGG + Intergenic
1009752282 6:67888322-67888344 ATGGATTACATTGGAAGCATAGG + Intergenic
1012151169 6:95756370-95756392 ATGGGTTACTTTGGAAACACTGG - Intergenic
1013075908 6:106771579-106771601 ATGGGTTAATGAGAAAGAACAGG + Intergenic
1015177990 6:130332031-130332053 ATGGATTAGTTAGGAGGCTATGG + Intronic
1015575432 6:134666147-134666169 CTGGAATAATGAGAAAGCACTGG + Intergenic
1017956035 6:159178533-159178555 ATGGCTACATTAGGTAGCACAGG - Intronic
1020219705 7:6226263-6226285 ATGCTTTGATTAGAAAGCACTGG + Intronic
1020951406 7:14682937-14682959 TTGGATTGATTAGGGAGCAGTGG - Intronic
1023725436 7:43138420-43138442 GTAAATTAATTAGGAACCACCGG + Intronic
1025577318 7:62664087-62664109 ATGGAACAGTTAGGAAACACTGG - Intergenic
1026645418 7:72163884-72163906 ATGGATTCATCAGGAAGCCTGGG - Intronic
1026948319 7:74330555-74330577 ATGAATCAATTAAGAAACACCGG - Intronic
1028721482 7:94037319-94037341 ATGAATAAATTGAGAAGCACTGG + Intergenic
1030755232 7:113279547-113279569 ATGGCTTCATTAGGAAACAAAGG + Intergenic
1030914431 7:115295173-115295195 ATGGGTAAATTATGAACCACAGG - Intergenic
1031466646 7:122120786-122120808 ATGGATTAAGAAGAAATCACAGG - Intronic
1034232874 7:149546379-149546401 AGGGATTAATAAGGAAGAAGAGG + Intergenic
1036141665 8:6214823-6214845 AGGGATTTATTAGGAAAAACTGG - Intergenic
1038470817 8:27817644-27817666 ATTGAGTAATTAGGCAGTACAGG - Intronic
1039327180 8:36498360-36498382 TTGGAGTAATTACGAGGCACAGG + Intergenic
1039650353 8:39334620-39334642 ATCAATTCATTATGAAGCACTGG - Intergenic
1039959986 8:42238856-42238878 ATGGATAATTTAGCAAGCAGGGG - Intergenic
1040885566 8:52259680-52259702 ATGGGTTAATTAGGAAGCAGAGG + Intronic
1043738224 8:83774634-83774656 ATGGATGAGTTGGGAAGGACAGG + Intergenic
1055354581 9:75424802-75424824 ATGGAATAAACAGGTAGCACAGG - Intergenic
1056045281 9:82708404-82708426 ATGGTTTAATCATGACGCACTGG + Intergenic
1058963687 9:110016610-110016632 ATGCATCAATTTGTAAGCACTGG + Intronic
1060803550 9:126560155-126560177 AAGGATTAATAGGGGAGCACTGG + Intergenic
1186270935 X:7887230-7887252 ATGAATTTACTAGGAAGCACTGG + Intergenic
1187712585 X:22068828-22068850 ATGGATAAAATAGGAGGCAGAGG + Intronic
1190502135 X:51089714-51089736 AAAGATTAATGAGAAAGCACAGG + Intergenic
1195877634 X:109558452-109558474 ATGGATTAAGTAGGCAGTACTGG + Intergenic
1196051009 X:111304169-111304191 AGGGATTAATTCTGAAGTACTGG + Intronic
1198766608 X:140086351-140086373 ATGGATTAAATGGAAAGCCCTGG + Intergenic