ID: 1157811881

View in Genome Browser
Species Human (GRCh38)
Location 18:50703177-50703199
Sequence ATGGAGAAGGGGAGTGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 911
Summary {0: 1, 1: 0, 2: 3, 3: 80, 4: 827}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157811881_1157811895 23 Left 1157811881 18:50703177-50703199 CCATGCTCACTCCCCTTCTCCAT 0: 1
1: 0
2: 3
3: 80
4: 827
Right 1157811895 18:50703223-50703245 TGCCTGGCCAGCCTGGGCAGTGG 0: 1
1: 0
2: 5
3: 70
4: 543
1157811881_1157811889 7 Left 1157811881 18:50703177-50703199 CCATGCTCACTCCCCTTCTCCAT 0: 1
1: 0
2: 3
3: 80
4: 827
Right 1157811889 18:50703207-50703229 GCCTGTACTTCTTCCCTGCCTGG 0: 1
1: 0
2: 0
3: 17
4: 216
1157811881_1157811892 17 Left 1157811881 18:50703177-50703199 CCATGCTCACTCCCCTTCTCCAT 0: 1
1: 0
2: 3
3: 80
4: 827
Right 1157811892 18:50703217-50703239 CTTCCCTGCCTGGCCAGCCTGGG 0: 1
1: 0
2: 5
3: 58
4: 510
1157811881_1157811891 16 Left 1157811881 18:50703177-50703199 CCATGCTCACTCCCCTTCTCCAT 0: 1
1: 0
2: 3
3: 80
4: 827
Right 1157811891 18:50703216-50703238 TCTTCCCTGCCTGGCCAGCCTGG 0: 1
1: 0
2: 3
3: 61
4: 680

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157811881 Original CRISPR ATGGAGAAGGGGAGTGAGCA TGG (reversed) Intronic
900438452 1:2642177-2642199 AGGGAGAAGAGCAGTGGGCAAGG - Intronic
900462045 1:2806211-2806233 GTGGCGAAGGGGTGTGGGCAGGG - Intergenic
901107125 1:6765173-6765195 GTGGAGAAAGGAAGTGAGCAGGG - Intergenic
902606507 1:17572268-17572290 ATGGAGCAGGGGGCTGAGGAGGG - Intronic
902677405 1:18018351-18018373 ATTGAGGAAGGGAGTGAGGAAGG - Intergenic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902777286 1:18682907-18682929 GTGGAGAAGGGGATTGAGTGAGG - Intronic
902833127 1:19030269-19030291 CTGGAGCAGGGGAGAGAGGAAGG + Intergenic
902992977 1:20202583-20202605 TTGGAGAAGGGGAAGGAGAATGG - Intergenic
903011070 1:20330786-20330808 ATGCAGAAAGGGACAGAGCATGG - Intronic
903116298 1:21181225-21181247 TTGGCTAAGGGGAGTGAGGACGG - Intergenic
903313654 1:22482386-22482408 GTGGAGAATGGGAGTGGGGAGGG - Intronic
903520952 1:23949416-23949438 AAGGAGAAGGGGGGTAAGTAAGG - Intergenic
904254732 1:29247758-29247780 AGGGAGATGGGGAGTGGGCCTGG + Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904329602 1:29749590-29749612 AAGGAAAGGGAGAGTGAGCAAGG + Intergenic
904341376 1:29837093-29837115 AGGAAGCAGGGGAGGGAGCAGGG - Intergenic
904807272 1:33140861-33140883 AAGGAGAAGGGGAGAGAGGAGGG - Intergenic
904834363 1:33325240-33325262 ATGGAGCAGGGGTCTGAACAGGG - Intronic
906125736 1:43425974-43425996 GTGGAGCAGGGGAGTGGGTAGGG + Intronic
906484254 1:46222123-46222145 CTGGAAAAGGAGAGGGAGCAAGG + Intergenic
907798795 1:57743620-57743642 ATGGAGAACGTGTTTGAGCAGGG + Intronic
908230017 1:62095003-62095025 CTGTAGAAGGGAAGTCAGCAAGG - Intronic
908429184 1:64039185-64039207 ATGGAGAAAGGGAGAAAGAATGG + Intronic
908488123 1:64615316-64615338 ATTGAGAATGGGAGAGAGCAGGG + Intronic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
909433984 1:75619107-75619129 AGGAAGAAGGGGAGGGAGGAAGG + Intergenic
909640144 1:77863296-77863318 AGGGAGGAAAGGAGTGAGCAGGG - Intronic
909897740 1:81094085-81094107 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
910437120 1:87216680-87216702 GGGGAGAAGGGGAGAGAGAATGG - Intergenic
910532217 1:88250469-88250491 AAGGAGAAAGGGAGGGAGGAAGG + Intergenic
911406864 1:97452114-97452136 ATGGAGAATGGGCGGGAGTAGGG - Intronic
911583447 1:99662065-99662087 AAGGAAAAGGGGAGTGAAGAAGG + Intronic
912308498 1:108595508-108595530 ATGGAGAAAGGGAGGGAGGGAGG + Intronic
912445625 1:109733923-109733945 ATGGACATGGAGAGTGAGTAGGG + Exonic
912977144 1:114341159-114341181 ATGGAGGAAGGGAGTGAAGATGG - Intergenic
913581809 1:120233859-120233881 ATGGAGAAGGAAAGAGATCAGGG + Intergenic
913626367 1:120664529-120664551 ATGGAGAAGGAAAGAGATCAGGG - Intergenic
914563740 1:148845306-148845328 ATGGAGAAGGAAAGAGATCAGGG + Intronic
914609087 1:149284920-149284942 ATGGAGAAGGAAAGAGATCAGGG - Intergenic
915356092 1:155255761-155255783 ATGGAGAGGGGTGGGGAGCAGGG + Intergenic
915492926 1:156261453-156261475 GTGGAGAACAGCAGTGAGCAAGG + Intronic
915536096 1:156536475-156536497 TAGGAGAAGGGGAGAGAGGATGG + Intronic
915806525 1:158859222-158859244 GTGGAGAAGGGATGTGAGAATGG - Intergenic
915893356 1:159791856-159791878 ACAGAGAAGGGGAGGGAGTAGGG - Intergenic
915898375 1:159828688-159828710 AGGGATAAGGGTAGTCAGCATGG + Intronic
915899178 1:159834197-159834219 GTGGAGAAAGGGAGTCAGCAAGG + Intronic
916178715 1:162065270-162065292 ATGCAGAAGGAGAGACAGCACGG - Intergenic
916838141 1:168570439-168570461 ATGAAGAATGAGAGAGAGCATGG - Intergenic
917455210 1:175180157-175180179 ATGGTGAAGGGCACAGAGCAGGG - Intronic
917926753 1:179795514-179795536 TGGCAGAAGGTGAGTGAGCAAGG - Intronic
918469966 1:184861726-184861748 AAGGAGAAGGGGAGGGAGGAAGG + Intronic
918590760 1:186238296-186238318 ATGGAGAAGTGGAGGGGGGAAGG + Intergenic
918761844 1:188420524-188420546 AAGGAGGAAGGGAGTGAGGAAGG - Intergenic
919554737 1:199036819-199036841 ATGGAGAAAAGGAATAAGCAAGG - Intergenic
919622324 1:199876758-199876780 ATCGAGAAGGAAAATGAGCAAGG + Intergenic
919892996 1:201989710-201989732 CTGGAGAGAGGGAGTGAGAAAGG - Intronic
919912697 1:202121663-202121685 AGGGAGGTGGGGAGAGAGCATGG - Intergenic
919996571 1:202757064-202757086 ATGGGGAAGGGCAGGGCGCAAGG + Intronic
920255614 1:204652225-204652247 AGGGCGAAGGGGAGAGAGGAGGG - Intronic
920788148 1:209062509-209062531 GGGTAGAAGGGCAGTGAGCAAGG + Intergenic
921333738 1:214065684-214065706 GTGGAGAAGGGGGGTGTGTAGGG - Intergenic
921339544 1:214121042-214121064 ATGGACAAGGGGAGTCAAAAGGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921807688 1:219474791-219474813 CTGGAGAAAGGGAGAGATCACGG - Intergenic
921819115 1:219596437-219596459 CTGGAAAAGAGGAGTGAGAAGGG + Intergenic
922119360 1:222647781-222647803 ATGGAGCAGAGGAATTAGCAAGG + Intronic
922544019 1:226441734-226441756 ATGGAGAAGGCGAGGCAGGAAGG + Intergenic
923001292 1:230008416-230008438 ATGGAGAAGGGGATGGCTCAGGG - Intergenic
923235782 1:232031447-232031469 AAGGAGAAGGGAAGGGAGAAGGG + Intronic
923375285 1:233355943-233355965 GAGGAGAAAGGGAGTGAACATGG - Intronic
923514204 1:234680961-234680983 AAGCTGCAGGGGAGTGAGCAAGG + Intergenic
924064908 1:240210998-240211020 AGGAAGAAGGGGAGGGAGGAAGG - Intronic
924428402 1:243974768-243974790 TAGGAGAAGAGGAGTGGGCAGGG - Intergenic
924904921 1:248442015-248442037 ATTGAGCATGGGAGTGAGGATGG - Exonic
924937128 1:248781586-248781608 CTAGGGAGGGGGAGTGAGCAGGG - Intergenic
1062784899 10:256203-256225 CTGGAGAAGTGGAGTGAGGCAGG - Intergenic
1062826349 10:571554-571576 ATGGGGAAGTGCAGTGAGGAAGG - Intronic
1062946756 10:1467398-1467420 AAGGAGATGGGGAGGGAGAAGGG - Intronic
1063065562 10:2605140-2605162 ATGGACCAGAGGAGTGAGCCAGG - Intergenic
1063365323 10:5487004-5487026 AGGTGGGAGGGGAGTGAGCAGGG - Intergenic
1063649393 10:7918210-7918232 AAGGAGAAGGGGCGTGATGAAGG + Intronic
1064020550 10:11805329-11805351 ATGGAGAATGGGAGAGAGCATGG - Intergenic
1064121424 10:12623080-12623102 ATGGAGGAAGGGAGGGAGGAAGG - Intronic
1064277135 10:13916381-13916403 ATCCAGAAGGGGAATGGGCAGGG - Intronic
1064533264 10:16331892-16331914 ATGGCAGAGTGGAGTGAGCAAGG + Intergenic
1065327609 10:24563064-24563086 ATGGAGAAGGGTGGGGAGGAGGG - Intergenic
1065876911 10:30005171-30005193 AGGGAGGGGGGGAGTGAGGATGG - Intergenic
1065951636 10:30657771-30657793 ATGGAGAAAGGGAGGGAGGGAGG - Intergenic
1066338381 10:34504075-34504097 ATGTGGAAGTGCAGTGAGCATGG - Intronic
1066596194 10:37052579-37052601 AGGGAGAAAGGGAGGGAGGAGGG + Intergenic
1067070171 10:43125349-43125371 CTGGAGGAGGGCAGTGAGTAAGG + Intronic
1067178986 10:43970848-43970870 GTGGAGCAAGGCAGTGAGCAGGG - Intergenic
1067216912 10:44310944-44310966 ATGGAGAAGGGGAGGGTGCGCGG + Intergenic
1067218682 10:44325417-44325439 CTGGAGAAGAGGAGTGAGGTAGG - Intergenic
1067222477 10:44353878-44353900 ATGGAGATGGGTAGGCAGCAAGG + Intergenic
1067391059 10:45864832-45864854 TTGGAGAAGGGGATTTGGCAGGG + Intergenic
1067541157 10:47154602-47154624 ATGGAGCAGGGGTGTGTGAAGGG - Intergenic
1067853470 10:49769850-49769872 AGGGAGAAGGGGAGAGAGGGAGG + Intergenic
1068316530 10:55351018-55351040 AGGGAGAGGGGGAGGAAGCAGGG - Intronic
1068830661 10:61491198-61491220 AAGGAGAAGGGAAGGGAGGAAGG + Intergenic
1070581805 10:77725947-77725969 CAGGAGATGGGGAGTGAGCAGGG - Intergenic
1070787625 10:79171147-79171169 GTGGAAAACGGGAGGGAGCAGGG - Intronic
1071168367 10:82833558-82833580 ATGCAGAAGGGCAGGGAACATGG - Intronic
1071304538 10:84286830-84286852 ATGGAGTAGGGGTGGGAGGAAGG + Intergenic
1071504155 10:86222702-86222724 GGGGAGAAGGGGTGTAAGCATGG + Intronic
1071561808 10:86651303-86651325 ATGGAAAAGGGGTAGGAGCAAGG + Intergenic
1072426418 10:95334441-95334463 ATGGAGAAGGGGCTTGTGCCAGG + Intronic
1072920746 10:99575151-99575173 ATGGGGTAGGGGAGGGAGCTAGG - Intergenic
1073615659 10:104992133-104992155 AGGGTGTAGGGGAGGGAGCAGGG + Intronic
1073654049 10:105393205-105393227 ATAGAGAAAAGGAGGGAGCAAGG + Intergenic
1073759346 10:106612983-106613005 ATGGGGGAGGGTAGTGAGCCGGG - Intronic
1073977948 10:109121678-109121700 ATGGAGGAAGGGAGGGAGGAAGG - Intergenic
1074137996 10:110644347-110644369 AAGGACAAGGGGACTGGGCACGG + Intergenic
1075387272 10:122064295-122064317 ATGGAGGAGGGAAGTGTGCATGG - Intronic
1075849414 10:125574907-125574929 ATGGAGGAGGGGAGACTGCAGGG - Intergenic
1075894640 10:125984276-125984298 CTGTAGCAGGGGAGAGAGCATGG + Intronic
1075911392 10:126128250-126128272 ATGAGGAAGGGAAGTGAGCTGGG + Intronic
1076069155 10:127472255-127472277 ATGGTGCAGGGGAGAGAGAAGGG + Intergenic
1076290550 10:129342490-129342512 AGGGAGAAAGGGAGAGAGGAAGG + Intergenic
1076571955 10:131438901-131438923 AGGGAGAAGGGAAGAGAGGAGGG - Intergenic
1077195784 11:1279308-1279330 AGGAAGGAGGGGAGTGAGCCAGG - Intronic
1077288703 11:1779033-1779055 ATGGAGAAGGGGATGGAGAGGGG - Intergenic
1077497166 11:2891954-2891976 GTGGAGAATGGGAGGGAGGAAGG - Intronic
1077523294 11:3049052-3049074 GAGGAGAAGGAGGGTGAGCAGGG - Intronic
1078263522 11:9734702-9734724 CTTGAGCAGGGGAGTGAGCATGG - Intronic
1078391528 11:10939187-10939209 ATGAAGGATGAGAGTGAGCAGGG - Intergenic
1079128766 11:17735692-17735714 AGGGAGAAAGGGAGGGAGAAAGG - Exonic
1079372459 11:19863217-19863239 ATGGAGAAGGAGCGAAAGCAAGG - Intronic
1079567855 11:21904618-21904640 ATGGAGAAAGGGAAGGAGAATGG + Intergenic
1080132517 11:28813689-28813711 ATGGATAGGGGCAGTGAGGAGGG - Intergenic
1080550350 11:33369139-33369161 AGGGAGAAGGGAAGGGAGAAGGG - Intergenic
1080741194 11:35065951-35065973 ATGGAAAAGGGGATGGGGCAAGG - Intergenic
1081114795 11:39187203-39187225 TTTGAGAAGGGTAGTGAGGAGGG - Intergenic
1081646328 11:44793004-44793026 AGGGGGAAGGGGAGGGAGCTGGG + Intronic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1081763577 11:45593762-45593784 CTGCAGGAGAGGAGTGAGCAAGG + Intergenic
1082132443 11:48506540-48506562 AAGGAGAAGGGAAGGGAGAAGGG - Intergenic
1082565871 11:54677089-54677111 AAGGAGAAGGGAAGGGAGAAGGG - Intergenic
1083170017 11:60918240-60918262 ATGGACGAGGACAGTGAGCAAGG - Intronic
1083181531 11:60988915-60988937 CTGGAGGAGGGGAGTGAGGAGGG - Intronic
1083187123 11:61024236-61024258 AGGGAGAAAGGGAGGGAGGAGGG - Intergenic
1083722258 11:64609151-64609173 AGGAAGGAGGGGAGTGGGCAGGG + Intronic
1083727508 11:64636260-64636282 AAGGAGAAGGGGAGAGAGGGTGG - Intronic
1083887276 11:65579048-65579070 AGGGGGAAGGGGAGGGAGAAAGG - Intronic
1084345291 11:68543104-68543126 ATGGAGGAGGGGAGTAAAAAAGG - Intronic
1084393236 11:68892097-68892119 GTGGAGAAGGGGAGCGAGGTGGG + Intronic
1084432234 11:69117514-69117536 CTGGGGAAGGGGAGCGAGAAGGG + Intergenic
1084443332 11:69188671-69188693 ATGGAGAAGGGGCACGAGCCAGG + Intergenic
1084605928 11:70171624-70171646 GTGGAGAAGGGGTGTGAGTTTGG + Intronic
1084729944 11:71066374-71066396 AGGGAGATGAGCAGTGAGCAGGG + Intronic
1084922717 11:72484119-72484141 AGGGTGAAGGGCAGTGAGCAAGG + Intergenic
1085159498 11:74327793-74327815 AGGGAGAGGGAGAGGGAGCAGGG - Intergenic
1085414323 11:76310213-76310235 GTGGAGAATGGGAGTGAGGTCGG - Intergenic
1085706919 11:78794716-78794738 ATGTAGAAGGAGATTGAGCCAGG + Intronic
1085723877 11:78937141-78937163 ATGGGGAAGGGCAGTGATCCTGG + Intronic
1085749128 11:79144778-79144800 GTTGGGAAGGGTAGTGAGCATGG + Intronic
1085759624 11:79230755-79230777 ATGGAGACAGGCAGTGGGCAGGG + Intronic
1085879402 11:80448208-80448230 AGGGAGAAGGGGAATGGGAAAGG - Intergenic
1087270296 11:96104470-96104492 TCAGAGAAGGGGAGTTAGCAAGG - Intronic
1088363990 11:109019780-109019802 ATGCAAGAGGGAAGTGAGCATGG + Intergenic
1088825473 11:113490229-113490251 ATGGAGAGGTGGAGTGTCCAGGG - Intergenic
1088897877 11:114091757-114091779 AAGGGGAAGGGGAGTGGGCTGGG - Intronic
1089473521 11:118739875-118739897 ATGGAGCAGGGAAAAGAGCAAGG + Intergenic
1090235354 11:125142824-125142846 ATGGACAAGGGGAAGGAGTAAGG + Intergenic
1091093514 11:132794559-132794581 AGGGAGATGGGGAGGGAGCCAGG - Intronic
1091467724 12:699880-699902 AGAGAGAAAGGGAGTGAGAAGGG + Intergenic
1091616877 12:2056145-2056167 ACGGAAAAGGTGAGGGAGCAAGG - Intronic
1091689604 12:2586807-2586829 CAGGAGGAGGGGAGTGAGGATGG - Intronic
1091800712 12:3323027-3323049 AAGGAGAAGGGAAGGGAGAAGGG + Intergenic
1091894939 12:4094312-4094334 AGGGAGAAAGGGAGGGAGAAAGG + Intergenic
1091947542 12:4561916-4561938 TTGAAGAAGGGGAGAGAGTAGGG + Intergenic
1091951229 12:4594582-4594604 GTGGAGCAGAGGAGGGAGCAGGG - Intronic
1092181954 12:6452204-6452226 GTGGAGAAGGGCGGTGGGCAAGG + Exonic
1092816622 12:12318075-12318097 GAGGAGCAGGGGAGTGGGCAGGG + Intergenic
1093092466 12:14937080-14937102 ATGGGGAAGGGGCAAGAGCATGG - Intronic
1093474492 12:19539621-19539643 ATGAAAAATGGGAGTGACCATGG + Intronic
1094702523 12:32883932-32883954 AGGGAGAAGGGGTGAGAGGAAGG - Intronic
1096038745 12:48495527-48495549 ATGGAGCAGGAGAGTGAAAAGGG - Intronic
1096654526 12:53080134-53080156 ATGGTGATGGGAAGGGAGCAAGG - Intergenic
1096666979 12:53172437-53172459 CTGGAGAAGGAGAGTAAGCCAGG + Intronic
1097354720 12:58588223-58588245 ATGGAGAAGGTCACAGAGCACGG + Intronic
1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG + Intergenic
1097754179 12:63390531-63390553 ATGGGGGAGGGGTGGGAGCAAGG + Intergenic
1098311611 12:69154364-69154386 AGGAAGAAGGGGAGTTGGCAGGG + Intergenic
1099644232 12:85330426-85330448 GTGGAGAAAGGGAGGGAGGAAGG - Intergenic
1100401029 12:94230092-94230114 ATGGAGAATGGGAGGGAGGAGGG - Intronic
1100642054 12:96491501-96491523 ATGGAGAAGGGAAGAGTCCAAGG + Intronic
1100733308 12:97498055-97498077 ATAGAGGAGGGGAGGGAACAAGG + Intergenic
1101308843 12:103557711-103557733 ATGGGGAAGGGGAGACAGGATGG - Intergenic
1101909973 12:108854023-108854045 AAGGAGAAGTGGAAAGAGCAGGG + Intronic
1101919401 12:108920025-108920047 ATGGAGAAGGCCAGTTGGCAAGG + Intronic
1101952428 12:109187104-109187126 AGGGAAGAGGGGAGTGAGGAAGG + Intronic
1102047606 12:109839793-109839815 ATGAAGGAAGGGAGAGAGCAGGG - Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102755198 12:115334170-115334192 CTGGAGAAGGAGAGGAAGCAAGG + Intergenic
1102786115 12:115606343-115606365 AGGGGGAAGGGGAGAGAGGAGGG + Intergenic
1102835449 12:116054095-116054117 GTGGAGCAGAGCAGTGAGCATGG - Intronic
1102926256 12:116828654-116828676 AAGAAGAAAGGGAGTGGGCAAGG + Intronic
1103222482 12:119257381-119257403 AGGGAGAAGGGGAGGGAAGAAGG + Intergenic
1103402147 12:120650348-120650370 AAGCAGAAGGGGAGAGTGCAGGG - Intronic
1103454642 12:121055396-121055418 ATGGAGGAGGGGAGGGAGGTGGG - Intergenic
1103472988 12:121196844-121196866 ATGGACAAGGGGAGGGGGAATGG - Intergenic
1103479981 12:121244633-121244655 AGGGAAAAGGGAAGTGAGAAGGG + Intronic
1103617312 12:122162513-122162535 AGGGAAAAGAGGAGGGAGCAGGG - Intergenic
1103678156 12:122672927-122672949 AGGGAGAAGGGGAGTGCGACAGG - Intergenic
1104629871 12:130391316-130391338 AGGGAAAAGGAGAGAGAGCACGG - Intergenic
1105494128 13:20915611-20915633 ATGGACAAAGGGGCTGAGCACGG + Intergenic
1105564385 13:21529894-21529916 ATGGAGAAGGGGAAGGATCAGGG + Intronic
1106180964 13:27369037-27369059 ATGGGGAAGGGGTGAGAGTAGGG + Intergenic
1106790595 13:33151833-33151855 ATGCAAAAGGGGAGTGAGAGTGG + Intronic
1106793188 13:33177721-33177743 AGGGAGAAAGGGAGGGAGGAAGG + Intronic
1107190625 13:37580651-37580673 ATGGAGAAAGGGAGTAAGCAAGG - Exonic
1108544783 13:51481962-51481984 GTGGAGAATGGGAGTGATGAAGG - Intergenic
1108753936 13:53477263-53477285 ATAGAGAAAGGAAGTGAGAATGG - Intergenic
1109061995 13:57632054-57632076 ATCGAGTGGGGGAGGGAGCAGGG - Exonic
1109143680 13:58749542-58749564 AAGGAGATGGGGAGTAAGCAGGG - Intergenic
1109297084 13:60547334-60547356 TGAGAGAAGGGGAGTGGGCAAGG + Intronic
1109512317 13:63394343-63394365 ATGGAGGAAGGGAGGAAGCAAGG + Intergenic
1109977231 13:69854337-69854359 ATGAAGAAAGAGAGAGAGCATGG + Intronic
1109984760 13:69965465-69965487 ATGGAGAAGGGGAGAAATGAGGG - Intronic
1110261243 13:73487463-73487485 ATGGTGAAGGGGAGCCAGTATGG - Intergenic
1110278869 13:73669580-73669602 ATGGAGCAAGGGAGTAAGCTGGG - Intergenic
1111166373 13:84462942-84462964 AAGGAGAAGGAGACTGATCAAGG - Intergenic
1112353459 13:98655386-98655408 ATGGAGAGGGGAAGTGCGCAGGG - Intergenic
1113339978 13:109412818-109412840 GTTGGGAAGGGGAGTGAGCCTGG + Intergenic
1113454719 13:110440103-110440125 ATGGAGGAGGGGTGTGAGGTTGG - Intronic
1113626602 13:111852510-111852532 ATGGACTAGGGGACTGAGGAAGG + Intergenic
1114186220 14:20404423-20404445 ATGGAGAATGTGATTGAGAAGGG - Intronic
1114406310 14:22459606-22459628 CTGGAGAAAGGTAGTTAGCATGG + Intergenic
1114842573 14:26282465-26282487 ATGGAGACGGAGAGGGAGTAGGG + Intergenic
1114863214 14:26553526-26553548 ACAGAGAAGGGAAGTGGGCATGG - Intronic
1114913188 14:27226755-27226777 ATGAATAAGGATAGTGAGCATGG - Intergenic
1115288209 14:31741345-31741367 AGGGAGGAGGGCAGTGAGCAGGG - Intronic
1117803488 14:59467301-59467323 TTGGAGATGGGGAGTGAAGAAGG + Intronic
1118055465 14:62075199-62075221 ATGGGGACTGTGAGTGAGCAGGG - Exonic
1118663633 14:68042603-68042625 ATGGGAAAGGGGAGGGAGAAAGG - Intronic
1118981927 14:70724189-70724211 CTGGAGAAGGGAAGTGATTATGG - Intronic
1118998783 14:70862089-70862111 AGGGAGAAAGGGAGGGAGGAAGG + Intergenic
1119542516 14:75450083-75450105 ATGGACAAGGGGAGTTGGGAGGG + Intronic
1119727138 14:76928365-76928387 GTGGAGGAGGGGAGTGGGGAAGG - Intergenic
1119804443 14:77473733-77473755 CAAGAGAAAGGGAGTGAGCATGG + Intergenic
1119940270 14:78633448-78633470 ATGTTGAAGGGGAGTGGGGAGGG - Intronic
1119984222 14:79117636-79117658 ATGGTGAGTGGGAGTGAGGAAGG + Intronic
1120460759 14:84792364-84792386 ATTCAGTTGGGGAGTGAGCATGG - Intergenic
1121217727 14:92261600-92261622 CTGGAGAAGGACAGTGATCAGGG - Intergenic
1121379883 14:93455337-93455359 ATGGAGATGTGGAGAGAACAAGG - Intronic
1121414199 14:93767747-93767769 ATGGAGAGGGGGGGTGTGTAGGG - Intronic
1121416081 14:93780064-93780086 AGAGAGATGGGGAGAGAGCATGG - Intronic
1122002068 14:98666966-98666988 AGGGAGAAAGGGAGGGAGGAAGG - Intergenic
1122059022 14:99124412-99124434 GTGGAGAAGGGGAAGGTGCATGG - Intergenic
1122707098 14:103628595-103628617 AATGAGAAGGGGAGGGCGCAGGG + Intronic
1123917712 15:25049035-25049057 AGGGAGAAAGGGAGGGAGGAAGG - Intergenic
1124424049 15:29548043-29548065 AAGTAGAAGGGGAGTTATCAGGG + Intronic
1124597371 15:31102232-31102254 CTGGTGAAGGGGGGAGAGCAGGG - Intronic
1124620290 15:31270166-31270188 AAAGAGAAAGAGAGTGAGCAGGG + Intergenic
1124647664 15:31450409-31450431 AGGGGGAAGGGGAGGGAGAAGGG + Intergenic
1124957776 15:34370922-34370944 GAGGAGAAGGGAAGTGAGGAAGG - Intergenic
1125087872 15:35752330-35752352 AGGGAGAAGGAGAGGGAGAAAGG - Intergenic
1125222016 15:37349479-37349501 ATGCAGAAGGGGAATCAGAACGG + Intergenic
1126175417 15:45730980-45731002 GTGGAGAAGGGGTGTGGGCTTGG + Intergenic
1126460160 15:48906503-48906525 ATTGAGAAGGGGAGTGGGTAGGG - Intronic
1126878268 15:53067330-53067352 GTGGAGGAGGGAAGGGAGCATGG - Intergenic
1126957260 15:53947444-53947466 TTGGAGATGGGGATTGAGTATGG - Intergenic
1128171376 15:65516986-65517008 ATGGGAGAGGGCAGTGAGCAGGG + Exonic
1128436200 15:67651524-67651546 ACTGAGAAGGGTAGTGAGAAAGG - Intronic
1129025235 15:72565786-72565808 ATGGGGAATGGGAAGGAGCAGGG - Intronic
1129231359 15:74198920-74198942 GTGGAGAAAGGGAGTGAGGCAGG + Intronic
1130174392 15:81553269-81553291 ATGGGGAAGGGGAATCAGCACGG - Intergenic
1131528624 15:93173090-93173112 AGGGAGATGGGGAGGAAGCAGGG + Intergenic
1131780064 15:95846328-95846350 AGGGAGAAGGGAAGAGAGGAGGG + Intergenic
1132872284 16:2121068-2121090 AAGGAGAAGGGGAAAGAGCCGGG + Intronic
1133636197 16:7668156-7668178 ACGGGGGAGGGGAGAGAGCAGGG - Intronic
1133839415 16:9394476-9394498 AGGGAGAAAGGGAGGGAGGAAGG - Intergenic
1133975091 16:10594891-10594913 ATGGAGGAGGGGCATGTGCACGG - Intergenic
1133978639 16:10617833-10617855 CTGGAGAGGGAGAGGGAGCAAGG + Intergenic
1134090684 16:11390265-11390287 CTGGAGCTGGTGAGTGAGCAAGG - Exonic
1134373222 16:13645150-13645172 ATGGAGAAGGGCAGAAAACAGGG - Intergenic
1134551333 16:15140147-15140169 AAGGAGAAGGGGAAAGAGCCGGG + Intergenic
1134565036 16:15244185-15244207 AGGGAAATGGGGAGGGAGCAGGG - Intergenic
1134610110 16:15601337-15601359 ATGGAGAAGGGAACTGGGCTAGG - Intronic
1134737460 16:16512511-16512533 AGGGAAATGGGGAGGGAGCAGGG + Intergenic
1134930050 16:18199647-18199669 AGGGAAATGGGGAGGGAGCAGGG - Intergenic
1135598886 16:23764797-23764819 AGGGAGAGGGGGAGAGAGAAAGG - Intergenic
1135728194 16:24873232-24873254 ATGGAGAGAGGGAGGGAGGAAGG + Intronic
1136532900 16:30881847-30881869 CGGGAGATGGGGAGAGAGCAGGG - Intronic
1137218675 16:46426530-46426552 AGGGAGAAAGGGAGGGAGGAGGG - Intergenic
1138250332 16:55497130-55497152 TTTGAGAGGGGGAGTGAGCCTGG - Intronic
1138443189 16:57047251-57047273 ATGGTCAAGGTGAGTGAGGATGG + Intronic
1138600538 16:58051522-58051544 AAGGAGAAAGGGAGGGAGGAAGG + Intergenic
1138869030 16:60858517-60858539 AGGGAGAGGGGAAGAGAGCAAGG + Intergenic
1139209979 16:65067849-65067871 TTGGAGAAAGGGAGGGAGAAAGG + Intronic
1139263938 16:65622284-65622306 AGGGAGGAGGGGAGTGAGAGAGG + Intergenic
1139592925 16:67943351-67943373 AGGGAGAGGGGGTGTAAGCAGGG - Intronic
1140099251 16:71900258-71900280 AGTGAGGAGGGGAGAGAGCAAGG - Intronic
1140657999 16:77159884-77159906 AAGAAGAAGGGGAGAGAGAAAGG - Intergenic
1140725565 16:77808465-77808487 ATGGAGCAGGGGTGGGAGGATGG - Intronic
1140985940 16:80158011-80158033 ATGGAGACAGGGACTGAGCCAGG + Intergenic
1140991514 16:80217304-80217326 AGGGAGAAGATGAGTGAACAAGG - Intergenic
1141678819 16:85531952-85531974 ATGGAGAAGGGGCGCGAGTAGGG + Intergenic
1142416560 16:89946604-89946626 AGGGAGAAGGTGAGTGAGTGAGG + Intergenic
1142978137 17:3657181-3657203 ATGGAGGAGGGGAGGGGCCAGGG + Intronic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG + Intronic
1143476383 17:7205845-7205867 ATGGGGATGGGGATTGAGGATGG - Intronic
1143523943 17:7461973-7461995 AGGGAGAAGGGGAAAGGGCAGGG - Exonic
1143610923 17:8016917-8016939 TTGCAGGAGGGGAGTGGGCACGG - Intronic
1143611307 17:8019419-8019441 AGGTAGAAGTGGAGTGGGCAGGG + Intronic
1143642187 17:8205396-8205418 AGGGATAAGGGGCGTGGGCAGGG + Intronic
1144142168 17:12360286-12360308 AGGGAGCAGGGGAATGAGGAGGG - Intergenic
1144235458 17:13256569-13256591 ATGGAGTAGAGAAGTGACCAAGG - Intergenic
1144503999 17:15814241-15814263 ATGGGGAAAGGGTGGGAGCAGGG + Intergenic
1144716065 17:17436684-17436706 TGGGAGAGTGGGAGTGAGCAGGG + Intergenic
1145940059 17:28738646-28738668 GGGGAGAAGGGCAGTGAGGAAGG - Intronic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1146944546 17:36864754-36864776 AGGGAGGAGGGGAGGGAGGAAGG - Intergenic
1146946580 17:36877627-36877649 GTGATGGAGGGGAGTGAGCAAGG + Intergenic
1147135223 17:38430168-38430190 AGGAAGAATGGGAGTGGGCAGGG + Intronic
1147360838 17:39928560-39928582 ATGGAGAATGGGAGTAACCGAGG - Intergenic
1147960839 17:44166772-44166794 GTGTAGATGGGGAGTTAGCAGGG - Intergenic
1148384308 17:47223195-47223217 CAGGAGATGGTGAGTGAGCAGGG - Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148770709 17:50064395-50064417 CTGGAGAAGGGGAGTTGGGAGGG + Intronic
1149345069 17:55726329-55726351 GTGGAGGAGGGCAGGGAGCATGG + Intronic
1150054982 17:62006308-62006330 AAGGAGAAGGGGAGACAGGAAGG + Intronic
1150064100 17:62094354-62094376 AGGGAGAAGGGCAGAGAGCAGGG + Intergenic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1150977812 17:70108788-70108810 AAGGAGAAAGGGAGGGAGGAAGG - Intronic
1150979348 17:70124236-70124258 ATGGAGAAGGGCCTGGAGCAAGG - Intronic
1151393527 17:73803941-73803963 ATGGGGAATGGGAGGGAGAAAGG - Intergenic
1151584809 17:75002698-75002720 ATGAAGAAGAGGTGTGGGCAGGG + Intronic
1151724787 17:75877681-75877703 ATGGAGATGGGAAGGGAGGAAGG - Intronic
1152315410 17:79577757-79577779 AAGGAGAAGGGGAGGGAGAGAGG + Intergenic
1152319571 17:79600933-79600955 GTGAAGGAGGGGAGTGAGGAAGG + Intergenic
1152859083 17:82685215-82685237 ATGGGGAGGGGGAGGGAGGACGG + Intronic
1152863424 17:82709122-82709144 ATGGAGTGGGGGATGGAGCAGGG - Intergenic
1153008014 18:514384-514406 ATGGGGATGGCGTGTGAGCAGGG - Intergenic
1153605041 18:6824636-6824658 ATGGAGAAGTGGAGTAACCATGG - Intronic
1156221911 18:35061447-35061469 ATGTGGCAGGGGTGTGAGCACGG - Intronic
1156453323 18:37279022-37279044 ATGGAGGAGGAGGGTGGGCACGG - Intronic
1156519357 18:37708727-37708749 ATAGAGAAGTGGAGAGAGGAAGG - Intergenic
1156540279 18:37903036-37903058 GTGGAGAAGGGCAGTGATGATGG + Intergenic
1156597746 18:38566702-38566724 ATGGAGGAAGGGAGAGAGGAAGG + Intergenic
1157084995 18:44570992-44571014 GTGGAGGAGGGGAGAGAGGAAGG + Intergenic
1157215857 18:45782914-45782936 ATGGAGGAGGGGAGGGAGAGTGG + Intergenic
1157231106 18:45916860-45916882 ATGGAGTTGGGGAGTGAGGAGGG - Intronic
1157277359 18:46320994-46321016 TAGGAGAAGGGGAGAGAGCTGGG + Intergenic
1157418791 18:47527533-47527555 ATGGAGGAGGAGACTGAGCTGGG + Intergenic
1157562584 18:48659348-48659370 ATGGAGGAGAGCAGTGGGCAAGG - Intronic
1157811881 18:50703177-50703199 ATGGAGAAGGGGAGTGAGCATGG - Intronic
1157901704 18:51524287-51524309 AGGCAGAAGGAGAGTGAGCTAGG + Intergenic
1158408005 18:57177667-57177689 CTAGAGAGGGGGAGTGACCAAGG + Intergenic
1158493497 18:57931714-57931736 AGGGAGAAGGGGACTGGACATGG - Intergenic
1158647902 18:59264217-59264239 CTGGAGAAGCGGACTGGGCAAGG + Intergenic
1158860782 18:61590186-61590208 ATGAAGAAGGGGAGGGAGGCAGG - Intergenic
1159022148 18:63152047-63152069 TTCGAGTAGGGGATTGAGCAGGG + Intronic
1159503003 18:69298097-69298119 ATGGAGAAGGGGCGAGGGAAAGG - Intergenic
1159903732 18:74071993-74072015 ATGGAGGAGGGAAGGAAGCAAGG - Intergenic
1159946497 18:74447914-74447936 CTGGAGAAGAGGAGGGACCAAGG + Intronic
1161582903 19:5090566-5090588 GGGGAGAGGGGGAGAGAGCAAGG - Intronic
1161754230 19:6119806-6119828 AGGGAGAAGGGGACAGAGAAAGG - Intronic
1162134322 19:8545797-8545819 ATGGAGAAGGGGAGAGGACATGG - Intronic
1162733096 19:12730677-12730699 ATGGCTAAGGGGAGGGAGGAGGG + Exonic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163186162 19:15640989-15641011 ATGGAGATGGGCACTGGGCAAGG + Intronic
1163238008 19:16040491-16040513 GTGGAGGAGGGGAGGGAGGAAGG + Intergenic
1163703184 19:18797101-18797123 AGGGAGAGGGGGAGGGAGGAAGG - Intergenic
1163779607 19:19239564-19239586 AGGGAGGAGGGGAGGGAGGATGG - Intronic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164680548 19:30131182-30131204 AGGGAGAAGGGGAGGGGGAAGGG - Intergenic
1165125842 19:33596575-33596597 ATTGCAAAGGGGAGTGGGCATGG + Intergenic
1165128990 19:33620867-33620889 ATGGAATTGGGGAGTGAGCTGGG - Intergenic
1165333192 19:35152730-35152752 AGGGAGAATGGGTGTAAGCATGG + Intronic
1165454202 19:35901222-35901244 ATGGAGATGGGGTGGGGGCAGGG + Intronic
1165953975 19:39490154-39490176 GTGGAGAAGGGAAGAGAGGATGG + Exonic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166325399 19:42047176-42047198 CTGGGGAAGGGGGCTGAGCATGG - Intronic
1166475347 19:43119671-43119693 AGGGAGAGAGGGAGGGAGCAAGG - Intronic
1166656092 19:44613220-44613242 ATGGACCTGGGGAGTGAGAAGGG + Intergenic
1166932171 19:46308141-46308163 TTGGAGCAGGGGAATGAGGATGG + Intronic
1167080508 19:47274022-47274044 ATGGGGAGGGGGCGTGAGGAGGG + Intergenic
1167197643 19:48041710-48041732 ATGGAGGAGGAGAGAGAGAATGG - Intronic
1167536465 19:50056033-50056055 AGGGAGAGAGGAAGTGAGCACGG + Intergenic
1167564741 19:50249204-50249226 AGGGAGAAGGGGAGAGACCCAGG - Intronic
1168261854 19:55199701-55199723 AGGGAGGAGGGGAGGGAGAAAGG + Intronic
1168295382 19:55375221-55375243 AGGGAGAAGGGGCGGGAGCCTGG - Intergenic
925415341 2:3666421-3666443 ATGATGAAGGGGTGTGTGCAGGG + Intronic
925595506 2:5551977-5551999 CTGGAGAGGGTGAGGGAGCAGGG + Intergenic
925784874 2:7422144-7422166 ATGGAGAGTGTGAGGGAGCAGGG + Intergenic
926230820 2:11002633-11002655 GTGCAGAAAGGGAGTGAGGAAGG + Intergenic
926244574 2:11113502-11113524 AGGAAGAAGGGGAGGGAGGAAGG - Intergenic
926796276 2:16621691-16621713 CTGGAGAAAGTGAGGGAGCAAGG - Intronic
927081405 2:19634311-19634333 ATGGAGAGGGGGATGGAGCGAGG - Intergenic
927083590 2:19653617-19653639 ATGGAGGAGGGCAGAGAGGATGG + Intergenic
927263306 2:21116742-21116764 CTGGAGGAGAGGAGTGAGGAGGG + Intergenic
927280837 2:21305024-21305046 AAGGAGAAGGGAAGTGGGGAAGG + Intergenic
927876887 2:26663008-26663030 ATGGGGTTGGGGAGTGTGCAGGG - Intergenic
928388346 2:30888732-30888754 AAGGAGAAGAGGAGGGTGCAGGG + Intergenic
929714051 2:44292924-44292946 TTGGAGAAGGGGTTTGAGTAGGG + Intronic
929897034 2:45969580-45969602 GTGGAGAAGGGGAGAGAAGAGGG - Intronic
930752172 2:54944981-54945003 ATGGGGGAGGGGAGGGAGAAAGG - Intronic
931133390 2:59366219-59366241 AGGGAGAAAGGGAGGGAGGAAGG + Intergenic
931220480 2:60284399-60284421 ATGGGGAAGGGGAGTGGGGCTGG - Intergenic
931752242 2:65339895-65339917 ACAGAGAAGGGGAGTTAGTAAGG - Intronic
932084555 2:68746663-68746685 AGGGAGAAGGGGCATGGGCATGG + Intronic
932106189 2:68944775-68944797 AGGGAGAAAGGGAGAGAGGAAGG - Intergenic
932759070 2:74427806-74427828 AGGGAAAAAGGGATTGAGCAAGG + Intronic
933450150 2:82438799-82438821 ATGGAGAAGGGGAGAAGGAAGGG - Intergenic
933967792 2:87444285-87444307 ATGGAGAAGGCAGGTCAGCATGG - Intergenic
934032549 2:88061366-88061388 ATAAAGAAGGGTAGTGAGAAAGG - Intergenic
934567676 2:95349593-95349615 ATGGACAAGGGGGCTGAGCCCGG + Intronic
934735710 2:96688903-96688925 GGGGTGAAGGGGAGGGAGCAGGG - Intergenic
934764517 2:96873206-96873228 GTGGAAAAGGGGAGGGAGCTGGG - Intergenic
935480558 2:103582984-103583006 AAGGAGAAAGGGAGGGAGGAAGG - Intergenic
936326008 2:111506214-111506236 ATGGAGAAGGCAGGTCAGCATGG + Intergenic
936679850 2:114757346-114757368 AGGGAGAGGGGGAGGGAGGAGGG + Intronic
937206301 2:120239107-120239129 AAGGAGATGGGGACTGAGCAGGG - Intergenic
937284468 2:120741483-120741505 AAGGAGAAGGGGAGAGAGAACGG - Intronic
938466870 2:131530386-131530408 ATGGAGAAGGGGGTTGAGGGAGG + Intronic
938566369 2:132522561-132522583 ATGGAGGAGGGAAGTAAGCCAGG + Intronic
938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG + Intronic
938823072 2:134978052-134978074 CTGGAGAAGGGAAGGGAGGAAGG - Intronic
939218873 2:139276376-139276398 CAGGAGAAGGGGAGTGAACCTGG + Intergenic
939365624 2:141226838-141226860 GTGGGGCAGGGGTGTGAGCAGGG - Intronic
939795263 2:146635280-146635302 AATGCGAAGGGGAGTGAGGAGGG - Intergenic
940139953 2:150483044-150483066 ATGGAGAAAGGGAGAAAGGAAGG + Intronic
940491021 2:154360926-154360948 ATGGGGAAGGGGAGTGAAGATGG + Intronic
941441735 2:165546131-165546153 GTGAAGAAGGGTATTGAGCATGG - Intronic
941520674 2:166537944-166537966 ATGGAGAGAGAGAGAGAGCATGG - Intergenic
942069024 2:172298652-172298674 GTGGAGAATGGGAGAGAGGAAGG + Intergenic
942319053 2:174719872-174719894 AAGGAGAAGGGGGGTAAGTAAGG + Intergenic
942954559 2:181759119-181759141 TTGCAGAAGGTGAGTGAGAATGG + Intergenic
943204469 2:184875453-184875475 AAAGAGAAGGGGAGCCAGCATGG - Intronic
943694905 2:190916337-190916359 ATGGAGTAGTGGGGTGAGCTGGG - Intronic
944635254 2:201670119-201670141 ATGGAGAGAGGGAGGGAGGAAGG + Intronic
945740734 2:213657969-213657991 AAGGAGAAAGGGATTGAGAATGG - Intronic
945816347 2:214609511-214609533 TTGCAGAAGAGGAGGGAGCAGGG - Intergenic
946111671 2:217425127-217425149 ATGAAAAAGGGGAATGAGCCAGG - Intronic
946401657 2:219471744-219471766 AGGGAGGAGGCGAGTGGGCAAGG - Intronic
946759886 2:222982998-222983020 ATGGAGACGGGAAGTGGGGAAGG - Intergenic
947077746 2:226363986-226364008 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077751 2:226363998-226364020 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077793 2:226364105-226364127 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077799 2:226364117-226364139 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077804 2:226364129-226364151 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077824 2:226364177-226364199 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077841 2:226364213-226364235 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077847 2:226364225-226364247 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077853 2:226364237-226364259 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077859 2:226364249-226364271 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077865 2:226364261-226364283 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077870 2:226364273-226364295 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077884 2:226364309-226364331 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947634565 2:231673464-231673486 GTGGGGAAGGGGAGGGAGCAGGG - Intergenic
947958225 2:234213104-234213126 ATGGAGAGGGGGAGGGTGCATGG + Intergenic
948086954 2:235258708-235258730 CTGGAGAAGGGGCGTGGGCAGGG - Intergenic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
948677648 2:239608185-239608207 ATGGAGAAAGGGAGTGTAAAGGG - Intergenic
948694317 2:239725544-239725566 AGGGAGAAGGTGAGTGAGGGAGG + Intergenic
1168868705 20:1110570-1110592 AAAGAGAAGGGGAGGGAGCAAGG - Intergenic
1168879685 20:1195906-1195928 ATGGAGAAGGTGAGTGTTGAGGG + Intergenic
1169004706 20:2196892-2196914 ATGGAGAAGGGCATGGAGGAGGG + Intergenic
1169148917 20:3274046-3274068 TCAGAGAAGGGGAGAGAGCAGGG - Intronic
1169178631 20:3542573-3542595 AGGGAGAAGGGGAAGGAGAAAGG - Intronic
1169345200 20:4823492-4823514 AAGGAGGAGGGGAGCGAGGAGGG - Intronic
1170310552 20:14986723-14986745 ATGGGGGAGGAGAGTGATCAGGG + Intronic
1170480742 20:16762528-16762550 ATGGAGAAAGGGAATCACCAGGG - Intronic
1170539838 20:17376409-17376431 ATGGAGAAGGGGGTCTAGCATGG - Intronic
1170900573 20:20458625-20458647 AAAGAGAAGGAGAGGGAGCAAGG + Intronic
1172202397 20:33135714-33135736 ATGGGGAAGGGGAGTGAGGGGGG + Intergenic
1172292089 20:33783981-33784003 ATGGAGAAGTGGAGGGAAAAGGG - Intronic
1172292132 20:33784120-33784142 ATGGGGAAGAGGAGGGAGAAGGG - Intronic
1172857937 20:38022310-38022332 AAGGAGATGAGGAGTAAGCATGG - Intronic
1172936604 20:38624969-38624991 ATGGAGGAGGGGAATGTGCTTGG - Intronic
1173125418 20:40331942-40331964 TTGGAGAAGGGAAGTGCCCAAGG + Intergenic
1173160281 20:40647278-40647300 ATAGAGAATTGGAGAGAGCATGG + Intergenic
1173284062 20:41654724-41654746 ATGGAGAAGGGTGGTGGGCGTGG + Intergenic
1173313066 20:41917667-41917689 AGGGAGAAGGGGAGGGAGTGGGG + Intergenic
1173614407 20:44393425-44393447 CAGGAGAAGGGCAGAGAGCAGGG - Intronic
1173860062 20:46277565-46277587 ATGGTGAAGGTGAGTGAAAAGGG + Intronic
1174098278 20:48106895-48106917 ATTGAGCAGGGGAGTGAGAAGGG - Intergenic
1174415192 20:50361355-50361377 AGGGAGAAAGGAAGAGAGCAGGG + Intergenic
1174500472 20:50980708-50980730 CTGGAGATGTGGAGTGAGCCGGG + Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1175077581 20:56389208-56389230 ATGGAGAAGTGGAGGGTCCAGGG - Intronic
1175493495 20:59395328-59395350 CTGGAGAAGGGGAGTAACCCGGG + Intergenic
1175654397 20:60755916-60755938 TTGGAGAAGGTGGGTGAGCCTGG + Intergenic
1175780199 20:61677188-61677210 CTGGAGTAGGGGAAGGAGCAGGG + Intronic
1176242632 20:64082221-64082243 AGGGAGAAGGGGCTTGAGCAGGG - Intronic
1176668945 21:9714024-9714046 AGGGAGAAAGGGAGTGAGGGAGG - Intergenic
1177115126 21:17075821-17075843 TTGGAGAAGGGAAATGAGCATGG + Intergenic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1178526047 21:33330297-33330319 ATGGGGCAGGGGAGTGAGTGGGG - Intronic
1178941884 21:36913420-36913442 AGGGAGAAGGGCAGTGGGCAGGG + Intronic
1179191978 21:39131067-39131089 ATGGAGAAGGGGGAAGAACATGG + Intergenic
1179557390 21:42188527-42188549 AGGGAGAAGGGGGCTGGGCAAGG + Intergenic
1179838694 21:44055840-44055862 AGGGAGAAGAGGACTGAGCCAGG + Exonic
1179900219 21:44388468-44388490 ATGGAGAAGGACAGTGATGATGG + Intronic
1179927104 21:44540753-44540775 AGGGAGAAGGGGAGCAAGGAAGG + Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1179959687 21:44761060-44761082 CTGGAGAAGGGGAGAGTCCAGGG + Intergenic
1180059106 21:45375545-45375567 ATGGAGGAGGGGGAGGAGCAGGG + Intergenic
1180100821 21:45584247-45584269 GTGGAGAAGGAGACAGAGCAGGG - Intergenic
1180590108 22:16930275-16930297 GTGGACATGGGGTGTGAGCAGGG + Intergenic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181506501 22:23361836-23361858 ATGAAGCAGGGGAGTGTCCAAGG - Intergenic
1181885306 22:26017367-26017389 AAGGAGGAGGGGAGGGAGGAAGG - Intronic
1181995927 22:26882471-26882493 ATGGAGAAAGGGAGTGAGAAGGG - Intergenic
1182060212 22:27391787-27391809 AGGGAGAAGGGAAGAGACCAGGG + Intergenic
1182263055 22:29089741-29089763 CTGGAGCAGGAGAATGAGCAGGG - Intronic
1182497376 22:30719188-30719210 AAAGAGAAGGGGAGTGAGGAGGG - Intronic
1182516521 22:30862127-30862149 ATGGAGAAGGAGAGTCTGCGAGG - Intronic
1182667634 22:31971062-31971084 ATGGAGGAGGCGTGTGAGCCGGG - Intergenic
1182824429 22:33252352-33252374 ATGGAGAAGGAGAGTTAGGCTGG - Intronic
1183153111 22:36053589-36053611 AGGGAGAAGGGAAGGGAGAAGGG - Intergenic
1183153127 22:36053637-36053659 AGGGAGAAGGGAAGGGAGAAAGG - Intergenic
1183153149 22:36053712-36053734 AGGGAGAAGGGAAGGGAGAAGGG - Intergenic
1183153153 22:36053724-36053746 AAGGAGAAGGGAAGGGAGAAGGG - Intergenic
1183153160 22:36053748-36053770 AGGGAGAAGGGAAGGGAGAAGGG - Intergenic
1183153172 22:36053779-36053801 AGGGAGAAGGGAAGGGAGGAGGG - Intergenic
1183153185 22:36053810-36053832 AGGGAGAAGGGAAGGGAGGAGGG - Intergenic
1183456197 22:37924633-37924655 ATGGGAAAGGAGAGTGAGCCAGG - Intronic
1184015665 22:41784093-41784115 ATGGAGGAGGCCAGTGAGGATGG + Intronic
1184656530 22:45944593-45944615 GTGGAGGTGGGGAGTGACCAGGG + Intronic
1185234796 22:49705426-49705448 AAGGCGGAGGGGAGTGAGGAGGG + Intergenic
1185326586 22:50228628-50228650 GTGGAGAAGGGGTCAGAGCAGGG - Intronic
949862108 3:8515365-8515387 ATGGAGGAGGGCACTGAGGAAGG - Intronic
950149623 3:10676495-10676517 ATGGGGATGGGGAGGGAGGAGGG + Intronic
950168244 3:10817311-10817333 ATGTAGAAGGGGAGAGGGAAAGG + Intronic
950223051 3:11211323-11211345 ATGAGGAAGGGGTGTGAGCCAGG + Intronic
950432812 3:12960824-12960846 AAGGGGAAGGGGAGTCAGCTGGG - Intronic
950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG + Intergenic
951567947 3:24030757-24030779 ATGGACAAGTGGAGTCAGCCTGG + Intergenic
951597205 3:24331287-24331309 AAAAAGAAGGGGAGAGAGCAGGG + Intronic
951975887 3:28508098-28508120 AAGGCAAAGGGGAGTCAGCAGGG + Intronic
952082220 3:29773184-29773206 AATGAGTAGGGGTGTGAGCATGG - Intronic
952174068 3:30842547-30842569 ATGGAGAAAGGGAGGAAGGAAGG + Intronic
952715369 3:36474521-36474543 GAGGAGAAGGGAAGTGAGCTGGG + Intronic
952759516 3:36901714-36901736 GTGGGGAAGGGGAGAGAGGATGG + Intronic
953206277 3:40832784-40832806 ATGGAGCAGAGGAGAGAGAAGGG - Intergenic
954505459 3:51067525-51067547 AGGGAGAAGGGAAGTGGGGAGGG - Intronic
954600442 3:51863475-51863497 AGGGAGAAGAGGAGGCAGCAAGG - Intergenic
954641077 3:52098250-52098272 CTGGAGGAAGGGTGTGAGCAGGG + Intronic
954672980 3:52300362-52300384 TAGGAGAAGGGGAGGGAGCGAGG + Intergenic
954940557 3:54368484-54368506 AAAGAGCAGGAGAGTGAGCACGG + Intronic
956309209 3:67860449-67860471 AGGCAGAAGGGGAGCGAGCAAGG + Intergenic
956758842 3:72419377-72419399 ATGGATAAGGGGAGAAAGGAAGG + Intronic
956769217 3:72510264-72510286 ATGGAGGATGGGAGGGAGGAAGG + Intergenic
956939918 3:74146651-74146673 ATGGAGAAGGGGACAGAGAAGGG - Intergenic
957558331 3:81788668-81788690 TTGGAGAAGGGAAGTGGGTAGGG - Intergenic
959807792 3:110578338-110578360 ATTGAGAAAGGGAGTGAGACGGG - Intergenic
959868060 3:111293450-111293472 ATGGTGCAGGGAAGTGATCATGG + Intronic
960298766 3:115976028-115976050 ATGGAGAAGGGTATTAAGCATGG - Intronic
960673319 3:120172301-120172323 ATGGAGAAGGGGACTAAACAAGG - Intronic
961563518 3:127747273-127747295 ATGGAGCAGGTGTGTGTGCAAGG - Intronic
961660268 3:128464929-128464951 AGGGGGAAGGGGAGGGAGGAAGG - Intronic
961670462 3:128524566-128524588 AGGGAGAAGTGGGCTGAGCACGG + Intergenic
961957932 3:130823565-130823587 ATGGACAAGGGGCTAGAGCAGGG - Intergenic
962023002 3:131519356-131519378 TTGGAGAGGTGGTGTGAGCAAGG - Intergenic
962338413 3:134559800-134559822 AAGGAGAAAGGGAGTGTGGAGGG + Intronic
962481471 3:135801944-135801966 AAAGGGAAGGGGAGTGAGAAGGG - Intergenic
962635924 3:137331388-137331410 ATGGAAAAGAAGAGTGAGCCAGG - Intergenic
963127265 3:141827451-141827473 ATAGAGAAGGGACATGAGCAGGG + Intergenic
964202878 3:154137899-154137921 ATGGAGAAGGGGATAGAGACTGG - Intronic
964380114 3:156090140-156090162 ATGGTGCAGTGGAGTGAGCTGGG - Intronic
964892190 3:161550740-161550762 ATTGAGAAGGTCTGTGAGCAGGG - Intergenic
966461403 3:180180625-180180647 AGGGAGAAAGGGAGGGAGGAAGG + Intergenic
966629031 3:182051369-182051391 TTGGAGGAGGGGAGTGATAAAGG - Intergenic
966743907 3:183257937-183257959 AGGGTGAAGTGGAGGGAGCAAGG - Intronic
966754143 3:183352722-183352744 ATCCAGAAGGGAAGTGAGGAGGG - Intronic
966819072 3:183910821-183910843 ATGGGGAAGGGGAGTGGGCCAGG + Intergenic
966955471 3:184873330-184873352 AGGGAGAAGATGAGTGAGAAGGG + Intronic
967241870 3:187447361-187447383 AGTGAGAAGGGGAGAGAGCTGGG + Intergenic
967317371 3:188161986-188162008 ATGGAGAATGGTAGAGAGCAGGG - Intronic
967364344 3:188669099-188669121 ATTGAGAAGGGAAGTGAGTGGGG + Intronic
967477053 3:189934219-189934241 GTGGTGAAGGGGAGTGATCAGGG - Intergenic
967767361 3:193295974-193295996 ACCATGAAGGGGAGTGAGCAAGG - Intronic
967788670 3:193523985-193524007 AAGCAGAAGGGAAGTGGGCATGG - Intronic
968530199 4:1087212-1087234 ATGGGGTAGGGGAGAGAGGACGG + Intronic
969315608 4:6379957-6379979 GTGGAGAAGGGGAGGTAGGAGGG - Intronic
969352247 4:6604484-6604506 ATGGGGAAGGGGAGTGACTGAGG + Intronic
969369004 4:6719263-6719285 AGGCTGCAGGGGAGTGAGCAAGG - Intergenic
969626837 4:8309869-8309891 AAGGAGAAGGGGAGTGCCCGGGG + Intergenic
969941783 4:10739335-10739357 GTGGAGCAGGAGAGAGAGCAAGG - Intergenic
970224556 4:13844119-13844141 ATGGAGGAAGGGAGGGAGAAAGG - Intergenic
970243396 4:14032802-14032824 CTGGGGAAAGGCAGTGAGCATGG - Intergenic
970249602 4:14100316-14100338 ATGGAGACAAAGAGTGAGCAAGG + Intergenic
970515804 4:16829052-16829074 AGGGAGGAGGGGAGTGGGTAGGG - Intronic
970690056 4:18611849-18611871 AAGGTGAAAGGGAGTGAGGAAGG + Intergenic
970882306 4:20946426-20946448 ATGCAGAAGACGAGTTAGCAAGG + Intronic
970977127 4:22055165-22055187 ATGGTACAGGGTAGTGAGCAGGG + Intergenic
972712264 4:41609147-41609169 AGGGAAAAGGGGAGGGAGCATGG + Intronic
973607048 4:52598437-52598459 AGGGAGAAGGGGTGTGATCATGG - Intronic
973619059 4:52709688-52709710 ATGGAGGAGGAGACTGAGAAAGG + Intergenic
973775523 4:54237894-54237916 ATGGTGAAGTGGAGAGGGCATGG + Intronic
974099863 4:57404837-57404859 GTGGAGAAAGGGAATGAGAAGGG + Intergenic
975012187 4:69370245-69370267 ATGGTGAAGGGGTGTGAGGATGG - Intronic
975328580 4:73087974-73087996 AAGGAAAAGGGGAGAGAGGAAGG + Intronic
975723287 4:77268744-77268766 ATGGAGGAGGGAGGTGAGCAGGG + Intronic
976006506 4:80436633-80436655 ATGGAGAAAGGGAGGCAGAAAGG - Intronic
976147029 4:82051991-82052013 AGGGTGTTGGGGAGTGAGCAAGG + Intergenic
976504087 4:85826277-85826299 ATGGAGAAGGGGATTAATGAAGG - Intronic
976510992 4:85910008-85910030 ATGGAGTGTGTGAGTGAGCATGG + Intronic
976579698 4:86721694-86721716 AGGGAGAGGGGGAGGGAGCGGGG - Intronic
977728070 4:100320798-100320820 AAGGAGAAGGGAAGGGAGGAAGG - Intergenic
978308915 4:107364135-107364157 AAGGAGAAGGGCAGAGAGAAGGG - Intergenic
978487807 4:109276012-109276034 ATGGAGGAGAAGAGTGAGCAGGG - Intronic
978518689 4:109596381-109596403 AGGGAGAAGAGGAGGCAGCAAGG + Intronic
978563560 4:110058544-110058566 ATGGACACGGGGCGTGAACAAGG + Intronic
978912675 4:114082905-114082927 AGGGAGAATGGGAGGGAGAATGG - Intergenic
979957027 4:126966787-126966809 ATAGAGAAAGTGAGTGAGAATGG - Intergenic
980649351 4:135689947-135689969 ATGGAGAATAGGAGTGAAAAAGG + Intergenic
980986335 4:139698568-139698590 AAGGAGAAGGGGGGTAAGTAAGG - Intronic
981495758 4:145390544-145390566 ATGGAGAAGGGGAGAGAGGGAGG + Intergenic
981690336 4:147500840-147500862 AGGAAGAAAGGGAGGGAGCATGG + Intronic
981902415 4:149882009-149882031 AAGGAATAGGGGAGTGAGCTTGG + Intergenic
982099129 4:151951465-151951487 ATGGACAAGGCAAGTGAACATGG - Intergenic
982099441 4:151953742-151953764 ATAGAGAAGGGGTGTGGGGAAGG - Intergenic
982219929 4:153115558-153115580 ATGGAGCAGGGGAGGGAGGCAGG + Intergenic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982274299 4:153623525-153623547 AAGTAGAAGAGGGGTGAGCAGGG - Intronic
982306875 4:153941775-153941797 CTGCAGAAGGGGAGTGATCAGGG - Intergenic
982688710 4:158524244-158524266 ATGGTCTAGGGGAGAGAGCACGG - Intronic
982766752 4:159357373-159357395 AGAGAGAAGGGGAGGGAGAAAGG + Intronic
983490733 4:168386003-168386025 AGGGAGAAGGGGAGAGAGAGAGG + Intronic
983954192 4:173677734-173677756 ATATAGAAGGTGAATGAGCAAGG + Intergenic
983957032 4:173710032-173710054 CCTGAGAAGGGGATTGAGCATGG + Intergenic
984581230 4:181512064-181512086 ATGAAGAAGGCGAGAAAGCAGGG - Intergenic
984911242 4:184676405-184676427 AGGGAGAAGGGAAGGGAGAAGGG - Intronic
984951271 4:185009490-185009512 AGGGAGAAGGCAAGTGAGGATGG + Intergenic
985231950 4:187827929-187827951 AAGGAGCAGGGGAGGGAGCTCGG - Intergenic
985265337 4:188151208-188151230 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265422 4:188151521-188151543 GTTGAGAAGGGGAGTGAGAGAGG + Intergenic
985265442 4:188151593-188151615 GTTGAGAAGGGGAGTGAGAGAGG + Intergenic
985265469 4:188151689-188151711 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265496 4:188151785-188151807 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265509 4:188151831-188151853 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265522 4:188151879-188151901 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265556 4:188151999-188152021 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265571 4:188152045-188152067 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265716 4:188152576-188152598 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265743 4:188152672-188152694 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265762 4:188152744-188152766 GTTGAGAAGGGGAGTGAGAGAGG + Intergenic
985265817 4:188152962-188152984 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265889 4:188153227-188153249 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265935 4:188153395-188153417 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265948 4:188153443-188153465 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265996 4:188153607-188153629 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985266136 4:188154136-188154158 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985266156 4:188154208-188154230 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985266176 4:188154280-188154302 GTTGAGAAGGGGAGTGAGAGAGG + Intergenic
985266182 4:188154304-188154326 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985266245 4:188154546-188154568 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985266291 4:188154714-188154736 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985405837 4:189637489-189637511 AGGGAGAAAGGGAGTGAGGGAGG + Intergenic
985564987 5:611284-611306 ATGGTGTAGGGGAGTGTGTAGGG - Intergenic
985630616 5:1012108-1012130 ATGGTGAGGGTGAGTGTGCAGGG - Intronic
986328868 5:6702962-6702984 AAGGGGAAGGGGAGTGAGAGGGG - Intergenic
986476460 5:8139074-8139096 AGGCAGTAGGGGAGAGAGCAAGG + Intergenic
986631607 5:9779197-9779219 ATGGAGCAAGGGAGAGAGGAAGG - Intergenic
986703890 5:10439644-10439666 ATGGAAAAGGAGAGAGAGCAGGG - Exonic
988333608 5:29875674-29875696 ATGGATAAGGGGACTCAGAATGG + Intergenic
988801198 5:34698154-34698176 AGGGAGGAGGGGAGGGAGGAAGG - Intronic
990230685 5:53710496-53710518 ATGGAAAACGGAAGAGAGCAGGG - Intergenic
990644026 5:57823006-57823028 AGGGAGAGAGGGAGTGAGAAAGG + Intergenic
990756707 5:59079877-59079899 GAGGAGAAGGGGAATGGGCAGGG + Intronic
992058553 5:73018801-73018823 ATGGAAAAGGGTAGAGAACAGGG - Intronic
992097122 5:73373170-73373192 ATGGAGATGGGGAATGACAATGG + Intergenic
992657922 5:78928969-78928991 TTGGGCATGGGGAGTGAGCAGGG - Intronic
993962653 5:94319174-94319196 AGGGAGAGAGGGAGTGATCAAGG - Intronic
994265518 5:97711433-97711455 ATGGAGGAAGGGAGAGAGAAAGG - Intergenic
995487881 5:112657493-112657515 ATGCTGAAGGGGTGTGGGCAGGG - Intergenic
995543872 5:113210518-113210540 ATTGAGAAAGGGACTGAGAATGG + Intronic
995655716 5:114423909-114423931 ATGGAGAAAGGGAAGGTGCAGGG + Intronic
995780543 5:115770550-115770572 AAGGAGAAGGGGGGTAAGTAAGG + Intergenic
996128914 5:119757409-119757431 ATGGAAAAGTAGAGTGAGCCAGG + Intergenic
997259144 5:132452359-132452381 ATAGAGAGGGGGAGTGAGAAAGG - Intronic
997618072 5:135266293-135266315 CTGGAGATGGGGAGGGAGCTGGG + Intronic
998094498 5:139389631-139389653 CTTGAGAAGGGGTGTGAGCAGGG + Intronic
998446984 5:142206012-142206034 AGGGACCAGGGGAGTGCGCAGGG + Intergenic
998526570 5:142848084-142848106 TTGGTGAAGGGGAGTGATCTGGG + Intronic
998540843 5:142980050-142980072 AGGGAGAAGGGGAGCGAGGAAGG - Intronic
999182671 5:149681109-149681131 GTGGAGCAGGGGAGGGAGGAGGG - Intergenic
999511883 5:152260756-152260778 ATGGGGAATGTGAGTGAGAATGG + Intergenic
999747127 5:154600889-154600911 AGGGAGAAGGGGCAGGAGCAGGG - Intergenic
1000247789 5:159463254-159463276 ATGCAGGAAGGGACTGAGCAGGG - Intergenic
1000469827 5:161627553-161627575 ATGGAGGAAGGGAATGAGGACGG - Intronic
1001303147 5:170552595-170552617 AGGGAGAAGGGGAGTGAGGGTGG + Intronic
1001634314 5:173198824-173198846 AGGGAGAAAGGGAGGGAGGAAGG - Intergenic
1002051506 5:176574164-176574186 ATAGAGAAGGTGAGTGTGAAGGG + Exonic
1002080322 5:176733657-176733679 ATGGAGAGGGTGACTCAGCACGG - Intergenic
1002398394 5:178976017-178976039 ATGGAGGAGTAGGGTGAGCAGGG - Intergenic
1002415000 5:179115701-179115723 AGGGAGAAAGGGAGGGAGAAAGG + Intronic
1003239965 6:4336010-4336032 AGGGAGAAGGAGGGTCAGCATGG + Intergenic
1004029494 6:11852449-11852471 GTGGAGGAGAGGAGGGAGCAGGG + Intergenic
1004255498 6:14059817-14059839 ATGCACAAGGGGTGTGAGGAGGG + Intergenic
1004359134 6:14955364-14955386 TTAGAGAAGTGGAGAGAGCAGGG + Intergenic
1004384554 6:15161450-15161472 ATGGAGAGCGGGAGTGAAGAGGG + Intergenic
1004603518 6:17173429-17173451 AGGGAGAAGGGGAAGGGGCAGGG + Intergenic
1005734278 6:28731174-28731196 AAGGAGCAGGAGAGGGAGCAAGG + Intergenic
1006187719 6:32190201-32190223 AGGGAGAAGGGGGGGGAGCGAGG + Intergenic
1006263391 6:32895189-32895211 AGAGAGAAGGGGAGGGAGAAGGG + Intergenic
1006369792 6:33636843-33636865 ATGGAGAAGGGAAGAGGGCCAGG + Intronic
1006563194 6:34931532-34931554 AAGCAGAAGGGGAGAGAGTAGGG - Intronic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1006725622 6:36197131-36197153 AAGGAGAAGGCGGGTGAGCGGGG + Intronic
1006876611 6:37303024-37303046 ATGGAGAAGGAAAGGAAGCAAGG + Intronic
1006911505 6:37566384-37566406 AGAGAGAAGGGGAGTGGGGAGGG + Intergenic
1006967604 6:38004451-38004473 ATGGAGAGGGGGAGAGGGGAAGG - Intronic
1007291497 6:40790750-40790772 AAGGAGAAAGGGAGAGAGGATGG + Intergenic
1007514374 6:42399706-42399728 ATGGGGAAGGAGAGGGAGTAGGG + Intronic
1007707560 6:43799999-43800021 ATGGAGATGGTGAGAGAGGAAGG + Intergenic
1007741045 6:44009636-44009658 AGGGAGAAAGGGAGGGAGGAAGG + Intergenic
1007762097 6:44139224-44139246 ATGGAGAAGGGGAGGGATGAAGG - Intronic
1008654813 6:53601208-53601230 TGGGAGAAGGGGAGAAAGCAGGG + Intronic
1008921738 6:56850098-56850120 ATGGAGACTGAGAGTGAGCAGGG - Intronic
1009438843 6:63651704-63651726 TTGGGGAAGGGGAAGGAGCAGGG - Intronic
1009566551 6:65318248-65318270 CTGGAAAAGAGGAGTGAGAAGGG - Intronic
1010062853 6:71645373-71645395 AAGGAGAGAGGGAGTGAGAAAGG + Intergenic
1010390778 6:75334726-75334748 GTGGAGTAGGGGGCTGAGCAAGG - Intronic
1010486037 6:76415917-76415939 ATGGCCATAGGGAGTGAGCAAGG - Intergenic
1011039438 6:83013884-83013906 TTGCAGAAGGGAAGTGATCAGGG + Intronic
1011445248 6:87432457-87432479 ATGGAGAGGGGGAGGCAGGAGGG - Intronic
1011616952 6:89206091-89206113 ATGGAGAGGGCGAGACAGCAGGG - Intronic
1011803379 6:91043920-91043942 GTTGAGAAGGTGAGTCAGCATGG - Intergenic
1012180768 6:96149979-96150001 ATGGAGAAGGGGGGTAAAGAGGG - Intronic
1012439189 6:99246631-99246653 AAGGAAAAAGGGAGGGAGCAAGG - Intergenic
1012586981 6:100935459-100935481 AGGGAGAAAGGGAGTGAGAAAGG - Intergenic
1013313980 6:108923914-108923936 AAGGAGGAGGGGAATGAGGAGGG - Intronic
1014554879 6:122833655-122833677 ATGGAGGAGGGGAGTAAAGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015305302 6:131700535-131700557 ACAGATAAGGGGATTGAGCATGG + Exonic
1016046981 6:139491398-139491420 GTGGAGGGGGGGAGAGAGCAAGG + Intergenic
1016792364 6:148079160-148079182 AGGTAGAAGGGGAGTGAGGAAGG + Intergenic
1016855243 6:148662855-148662877 ATGGGGAAGGGGAAAGATCAAGG - Intergenic
1017884572 6:158588332-158588354 AGAGAGGAGGGGAGTGTGCAGGG - Intronic
1018757971 6:166865920-166865942 ATGGAGAAGGGGAGGGAAGGAGG + Intronic
1019158269 6:170052929-170052951 ATGGAGAGAGGGAGGGAGAAAGG - Intergenic
1019901959 7:4027960-4027982 ATGGAGGAGGGGAGGGAGAGAGG + Intronic
1019964085 7:4484702-4484724 AGAGAGAAGGGGAGAGAGGAGGG + Intergenic
1021086439 7:16425621-16425643 AGGGAGATGGGGAGTGGGGAGGG - Intergenic
1021289383 7:18823995-18824017 AAGGAGAAGGGGAATGGGAAGGG + Intronic
1021315537 7:19144126-19144148 GTGGCGAAGGGGAGGGAGAAAGG + Intergenic
1021410387 7:20323564-20323586 TTGGAGAAGGGGGCTGAGAATGG + Intergenic
1021695239 7:23269909-23269931 ACAGAGAAGGGGAGAGAGGAAGG - Intronic
1022063014 7:26819591-26819613 ACTGAGAAGGGGAGAAAGCATGG - Intronic
1022090669 7:27106235-27106257 AGGGGGAGGGGGAGAGAGCAAGG - Exonic
1023441219 7:40186717-40186739 AGTGAGCAGGGAAGTGAGCAAGG + Intronic
1023733922 7:43218483-43218505 GTGGAGAAGGGAAGGAAGCAAGG + Intronic
1023741715 7:43287189-43287211 ATAGGGAAAGAGAGTGAGCATGG + Intronic
1023911143 7:44557680-44557702 AAGGGGAAGGGGAGGGAGGAAGG + Intergenic
1024216637 7:47254331-47254353 AGGGAGACGGGGAGGGAGAATGG - Intergenic
1024217119 7:47256928-47256950 ATGGAGACGGTGAGGGAGGAGGG + Intergenic
1024619708 7:51146971-51146993 ATGGTGATGGGGAGCCAGCAGGG + Intronic
1024737743 7:52323528-52323550 AGGGAGAAGGGAAGTGGGAAGGG - Intergenic
1025059994 7:55797941-55797963 CTGGAGAAGGGGAGTGGGAGGGG - Intronic
1025251663 7:57355287-57355309 AGGAAGAAAGGGAGAGAGCATGG - Intergenic
1025255295 7:57380828-57380850 AGGGAGAAAGGAAGAGAGCAGGG - Intergenic
1025673199 7:63627374-63627396 AGGTAGAAGGGGAGGGAGGAGGG + Intergenic
1025776812 7:64568055-64568077 GTGGAGAAGAGGAGAGGGCAAGG - Intergenic
1026123240 7:67556097-67556119 AAGGAGAAAGGGAGGGAGGAAGG - Intergenic
1026133194 7:67636985-67637007 AAGGAGAAGGGGAGGAAGGAAGG - Intergenic
1026298782 7:69079082-69079104 ATGGAGGAGGGGAGGGGGAATGG + Intergenic
1026355486 7:69553564-69553586 CTGGAGAAGGGAAGTGGGGAAGG - Intergenic
1026620242 7:71943879-71943901 ATGAAAATGGGGAGTGAGCATGG + Intronic
1026649553 7:72203511-72203533 AGGGAGAAGGGGAGTTATCAAGG - Intronic
1026834829 7:73631738-73631760 AGGGAGAAGGGGAGAGAGGAAGG - Intergenic
1027225555 7:76241413-76241435 ATGGAAAAGGGCAGGGAGCCTGG + Intronic
1029628873 7:101737821-101737843 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
1030017024 7:105233045-105233067 AGGGAGAGAGGGAGGGAGCAAGG + Intronic
1030497318 7:110315974-110315996 ATGGGGGAGGGTAGTGAGCATGG - Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031706452 7:124985751-124985773 AGAGAGAAAGGGAGTGAGAAAGG + Intergenic
1031732992 7:125320864-125320886 ATAGAGAAAGAGAGTGAGGAGGG - Intergenic
1032576375 7:133059411-133059433 ATGGAGGAGGAAAGTGAGGAGGG + Intronic
1032663509 7:134012040-134012062 ATGGATGAAGTGAGTGAGCAGGG + Intronic
1032816980 7:135485696-135485718 ATGGAGAAGGGAAGGGGGAAGGG + Intronic
1032902785 7:136329708-136329730 ACGGAGAATAGGAGTGAGAAAGG + Intergenic
1033033990 7:137853892-137853914 ATGGAGAAAGGGAATGTGAATGG - Intergenic
1033531808 7:142271765-142271787 CTGGAAAAGGGGGGTGAGCTGGG - Intergenic
1033588145 7:142789379-142789401 ATGCAGAAGTGGAGTTAGAATGG - Intergenic
1033739413 7:144258762-144258784 ACAGATAAGGGGATTGAGCATGG + Exonic
1033994541 7:147329615-147329637 ATGGAGGAGGGCAGAGGGCATGG + Intronic
1034129430 7:148701331-148701353 AGGGAGAAGGGAAGTGAAGAGGG - Intronic
1034336520 7:150327212-150327234 AAGGAGAAGGGAAGTGAAAAGGG + Intronic
1034394082 7:150807021-150807043 TGGGAGAAGGGGAGGAAGCAGGG - Intergenic
1034405331 7:150899020-150899042 ATGGAGGAGGGGACAGAGAAGGG + Intergenic
1034463186 7:151209807-151209829 ACCGAGAAGAGGAGTGATCAGGG - Intronic
1034679203 7:152915798-152915820 AAGGAGAAGGAGGGTGAGAAGGG - Intergenic
1034821928 7:154223841-154223863 AGGCAGGAGGGGAGTGAGCATGG + Intronic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1035264633 7:157684423-157684445 GTGGGGGAGGGGAGTGAGCAGGG + Intronic
1035335452 7:158125008-158125030 GGGGAGAAGGGGAGACAGCATGG + Intronic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035789258 8:2288895-2288917 ATGGCTAAGGAGAGAGAGCAAGG - Intergenic
1035803547 8:2432810-2432832 ATGGCTAAGGAGAGAGAGCAAGG + Intergenic
1035973804 8:4284444-4284466 ATGGTGACGGGGAGGGAACACGG - Intronic
1036117466 8:5973407-5973429 ATGTGGAAGGGAAATGAGCATGG - Intergenic
1036149233 8:6282718-6282740 AGGGAGAAAGGGAGAGAGGAAGG + Intergenic
1036504249 8:9340940-9340962 TTGGGGAAGGGGAGGGAGAAAGG + Intergenic
1037108260 8:15136663-15136685 ATGGAGAATGAGAGCAAGCAGGG - Intronic
1037122902 8:15310578-15310600 ATAGAGAAGGTCAGGGAGCACGG - Intergenic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1037910935 8:22743190-22743212 CTGGGGCTGGGGAGTGAGCAAGG + Intronic
1038077386 8:24091605-24091627 CTGGTGAAGTGGAGTGAGCAAGG + Intergenic
1038150959 8:24942146-24942168 AAGGAGAAGGGGAGGGAGGTGGG - Intergenic
1038281957 8:26173844-26173866 ATGGAGAAGGTGAGTTTGCAGGG + Intergenic
1038327058 8:26579309-26579331 ATGGGGAGAGGGAGGGAGCAGGG - Intronic
1038495497 8:27999327-27999349 ATGGAGGAGGCTAGTGGGCAGGG - Intergenic
1038619819 8:29131175-29131197 GGGGAGCAGGGAAGTGAGCAAGG + Intronic
1039183975 8:34895858-34895880 TTGGAGAGGGGGATTTAGCAGGG - Intergenic
1039466209 8:37787117-37787139 GAGGAGAAAGGGAGAGAGCAGGG + Intronic
1040016030 8:42700884-42700906 ATGGAGGTGGGAAGAGAGCAGGG + Intronic
1040676643 8:49757994-49758016 ATGGAGAAATGGAGTAGGCAGGG - Intergenic
1041098526 8:54373455-54373477 GTGTTGAAGGGGAGTGAGCCCGG + Intergenic
1041110805 8:54480666-54480688 ATGGAGAAGGGAGGGGAGCAAGG + Intergenic
1041330518 8:56719304-56719326 AAGGAGGAGGAGAGGGAGCAGGG - Intergenic
1041391000 8:57347396-57347418 TTGGATATGGGGGGTGAGCATGG + Intergenic
1041854918 8:62440659-62440681 AGGAAGGAGGGGAGTGAGTATGG - Intronic
1042318959 8:67454954-67454976 ACAGAGGAGGGGAGAGAGCAGGG + Intronic
1042939848 8:74096563-74096585 ATAGAGCAGGAGAGTCAGCAGGG - Intergenic
1043119402 8:76303724-76303746 ATGGAGAAAGGGAGGAAGGAAGG + Intergenic
1044619116 8:94172000-94172022 CGGGAGAAGGGGAGGGAGGAGGG - Intronic
1045155288 8:99462149-99462171 AGGGAGAAAGGGAGGGAGGAAGG - Intronic
1045723779 8:105146228-105146250 AAGGAGAATGGGAGTGATGAAGG - Intronic
1046353761 8:113050980-113051002 TGGGAGAAGGGAAGTGAGAAAGG + Intronic
1047329264 8:123871456-123871478 GTGGGGGAGGGGAGTGGGCAGGG - Intronic
1048212972 8:132471412-132471434 ATTGCCAAGGGGAGTGTGCATGG + Intronic
1048421581 8:134283289-134283311 GTGGGGAATGTGAGTGAGCATGG + Intergenic
1048443031 8:134473941-134473963 ATGGAGGAGGGGAGGCAGCTGGG + Intergenic
1048551692 8:135439075-135439097 AGGGAGAGAGGGAGGGAGCAAGG + Intergenic
1049040361 8:140108107-140108129 ATGGAGAAGGGGTGGGGGCGGGG + Intronic
1049155292 8:141062534-141062556 ATGGGGAAGTGGAGGGATCATGG + Intergenic
1049521185 8:143092206-143092228 ATGGTTGAGGGGAGAGAGCAGGG + Intergenic
1050359922 9:4820213-4820235 TTGAAGAAGAGGAGTCAGCAGGG + Intronic
1051552956 9:18350485-18350507 ATTGAGAAGGGAAAGGAGCAAGG + Intergenic
1052141092 9:24984929-24984951 ATGGAGAAGGGAAAGGAGAAAGG + Intergenic
1053380952 9:37649813-37649835 ATAAAGCAGGGGAGTCAGCAGGG - Intronic
1055518138 9:77053765-77053787 ATGGAGATGGAGAGGGAGTAGGG - Intergenic
1055559443 9:77508096-77508118 ATAGAGAATGAGAGAGAGCAGGG - Intronic
1056277111 9:85004105-85004127 AGGGAGGAAGGGAGTGAGGAAGG + Intronic
1056523180 9:87418861-87418883 AGGGAGAAGAGAACTGAGCAAGG - Intergenic
1056780152 9:89543154-89543176 CTGGAGAAGGGGTGGGGGCAGGG + Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057435934 9:95040605-95040627 ATAGAGGAGGGGAGGGAGAAAGG - Intronic
1057447141 9:95124546-95124568 AACTAGAAGGGGAGTGAGGAAGG - Intronic
1057759570 9:97861312-97861334 AGGGAGCAGGGGAGGAAGCAGGG - Intergenic
1058035342 9:100246209-100246231 ATGGAGAAGAGAAGAGAACAAGG + Intronic
1058375301 9:104316069-104316091 AGGGAGAAGGGGAGGGAGAGGGG - Intergenic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059151507 9:111953581-111953603 ATGGAGAAGGGGAGAAAGTATGG - Intergenic
1059876903 9:118645295-118645317 AGGGAGAAAGGGAGGGAGAAAGG - Intergenic
1061527479 9:131178803-131178825 CTGGAGAAGGGAAGTGAGGGAGG - Intronic
1061679311 9:132235120-132235142 AGGTAGAAGGGCAGTGATCAGGG + Intronic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1062112752 9:134790985-134791007 CAGGAGCATGGGAGTGAGCAAGG - Intronic
1062464988 9:136676947-136676969 AGGGAGAACGTGAGTGTGCAGGG - Exonic
1062476997 9:136733161-136733183 ATGGGGAAGGGGAGAGTGCTGGG + Intergenic
1203656921 Un_KI270753v1:6911-6933 AGGGAGAAAGGGAGTGAGGGAGG + Intergenic
1185585714 X:1240873-1240895 ATGGAGATTTGGGGTGAGCAGGG + Intergenic
1185708511 X:2282852-2282874 AGGGAGAAGGGGAGAGAGAGGGG + Intronic
1185821525 X:3209289-3209311 ATGGGGAAGGGCTGTGAGTAGGG - Intergenic
1186264634 X:7818805-7818827 AAGGAGAAGGGGAAGGAGTAGGG + Intergenic
1186342321 X:8657833-8657855 AGGAAGAAGGGGAGTGAGGCAGG + Intronic
1187260775 X:17683392-17683414 ATGGGGTAGGGGAGTGAGAATGG - Intronic
1187309063 X:18123127-18123149 AAGGAGAAGGGGAGTGGGGGAGG - Intergenic
1187410347 X:19045661-19045683 ATGGAAGGGGGCAGTGAGCATGG - Intronic
1187444225 X:19346210-19346232 AGGGAGAAGGGGAGGGAGAAGGG + Intronic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1188039769 X:25358216-25358238 ATGAAGAGGCAGAGTGAGCAAGG - Intergenic
1188520670 X:31034169-31034191 ATGGAGAAGGGAAGATAGGAGGG - Intergenic
1189055591 X:37696459-37696481 ATGGAAAAAGGAAGTGGGCATGG + Intronic
1189110553 X:38285960-38285982 AGGAAGAAGGGGAGGGAGAAGGG - Exonic
1189110697 X:38286386-38286408 AAGGAGAAGGGGAGGAAGAAGGG - Exonic
1189230769 X:39450895-39450917 ATGGAGGAGGGGAGAGTGGAGGG - Intergenic
1189284088 X:39839628-39839650 ATGGAGTTGGGGAGTGGGAAGGG - Intergenic
1190188874 X:48258906-48258928 ATGGAGAAGGGGCGGGGGCAGGG + Intronic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1190644261 X:52510255-52510277 ATGGAGAGGGGGAGGAAGGAAGG - Intergenic
1190657758 X:52626663-52626685 ATGGAGAAGGGCCGGGGGCAGGG + Intergenic
1190775533 X:53549571-53549593 ATGGGGGAGGGGAATGAGCTAGG + Intronic
1191681728 X:63847642-63847664 GTGGAGGAGTGGAATGAGCACGG + Intergenic
1191833230 X:65437281-65437303 ATAGAGCAGGGGAGTGGGGATGG - Intronic
1193593863 X:83422202-83422224 TTGGAGAAGGAGAGAGAGAAGGG - Intergenic
1195943051 X:110180842-110180864 ATGGAGAAGGGAAGTGTGGAAGG - Intronic
1196091787 X:111751957-111751979 AAAGAGAAGGGCAATGAGCAAGG - Intronic
1196197650 X:112852884-112852906 AGGCAGGAGGGGAGGGAGCAGGG - Intergenic
1196305301 X:114095538-114095560 ATGGGGAATGGGAGGGAGGAGGG - Intergenic
1196898418 X:120360268-120360290 AGGGACAAGGGGAGGGAGAAAGG - Intergenic
1197106311 X:122720701-122720723 AGGGAGATGGGGAGAGAGGAGGG + Intergenic
1197146313 X:123176394-123176416 AGGGAGGAGGGGAGTGAGGGAGG - Intergenic
1197179040 X:123514434-123514456 AAGGAGAAGGGGGGTAAGTAAGG + Intergenic
1197867867 X:131037652-131037674 AAGGAAAAGGGGAATGAGAAAGG - Intergenic
1198302642 X:135346278-135346300 ATGGTGGAGGGGAGTGGGGAAGG + Intronic
1198950468 X:142065347-142065369 AGGAAAAAGGGGAGTGAACAAGG + Intergenic
1199319853 X:146425529-146425551 ATGGAGAAAGAGAGTGAGATAGG + Intergenic
1199550577 X:149057025-149057047 ATGGAGGAGGGGTGGGAACAGGG - Intergenic
1199612788 X:149631932-149631954 ATGGAGGCTGGGAGTGAGCAGGG + Intergenic
1199871802 X:151904841-151904863 ATGGAGAAGGGGCGGGAACAGGG + Intergenic
1199895910 X:152127741-152127763 ATGGAGGAGGGGTGGGAACAGGG - Intergenic
1199951367 X:152708690-152708712 ATGGAGGAGGGGTGAGAACAGGG + Intergenic
1199954014 X:152727914-152727936 ATGGAGGAGGGGTGAGAACAGGG + Intronic
1199955678 X:152740539-152740561 ATGGAGAAGGGGTGAGAACAGGG - Intergenic
1199958316 X:152759771-152759793 ATGGAGGAGGGGTGAGAACAGGG - Intergenic
1199966544 X:152825086-152825108 ATGGGGAAGGAGAGGGAGCTGGG - Intergenic
1200341240 X:155398597-155398619 CTGGAGTAGGGGAGTGGACAGGG + Intergenic
1201388151 Y:13466008-13466030 ATGGAGTATGGTAGTCAGCATGG - Intronic
1201550135 Y:15210514-15210536 AGGGAGGAGGGGAGAGAGGAAGG + Intergenic
1201853305 Y:18512893-18512915 AGGGAAAAGGGAAATGAGCAAGG - Intergenic
1201880016 Y:18807491-18807513 AGGGAAAAGGGAAATGAGCAAGG + Intronic
1201945175 Y:19503199-19503221 AGGGGGAAGGAGAGGGAGCAAGG + Intergenic