ID: 1157812022

View in Genome Browser
Species Human (GRCh38)
Location 18:50704049-50704071
Sequence GTCACAAGGTCTGCCTGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157812022_1157812027 14 Left 1157812022 18:50704049-50704071 CCTTTCCAGGCAGACCTTGTGAC 0: 1
1: 0
2: 2
3: 10
4: 128
Right 1157812027 18:50704086-50704108 AACTTCAGGTAAGCTCTCTAGGG 0: 1
1: 0
2: 1
3: 10
4: 110
1157812022_1157812026 13 Left 1157812022 18:50704049-50704071 CCTTTCCAGGCAGACCTTGTGAC 0: 1
1: 0
2: 2
3: 10
4: 128
Right 1157812026 18:50704085-50704107 AAACTTCAGGTAAGCTCTCTAGG 0: 1
1: 0
2: 1
3: 22
4: 182
1157812022_1157812025 0 Left 1157812022 18:50704049-50704071 CCTTTCCAGGCAGACCTTGTGAC 0: 1
1: 0
2: 2
3: 10
4: 128
Right 1157812025 18:50704072-50704094 AGAGAGACTTTTAAAACTTCAGG 0: 1
1: 0
2: 3
3: 36
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157812022 Original CRISPR GTCACAAGGTCTGCCTGGAA AGG (reversed) Intronic
901530430 1:9849360-9849382 CTCTCCAGGTCAGCCTGGAAGGG - Exonic
905494073 1:38370766-38370788 GTCACAAACTCTAACTGGAAGGG - Intergenic
907300089 1:53481589-53481611 GTCACAAGGTCTGTGTGTCAGGG + Intergenic
907413512 1:54298540-54298562 GTCCCACGCTCTGCCTAGAAGGG - Intronic
907417449 1:54324320-54324342 GTGCCAAGGACTGTCTGGAAGGG - Intronic
907621027 1:55980759-55980781 GTTACATGGTTTGCCTGGCATGG - Intergenic
907908017 1:58801982-58802004 GCCACAAGGTCTTCATGAAAAGG + Intergenic
912729028 1:112085258-112085280 GTCACTAGGTCTGCGTGGATGGG - Intergenic
912941563 1:114049598-114049620 GTTACAAGGGCTGGCTGAAAGGG - Intergenic
914445823 1:147749917-147749939 GGCACAAGGTCTGGAGGGAAAGG + Intergenic
916424851 1:164670519-164670541 GTCAGAATGTCTGCAAGGAAAGG - Intronic
918317795 1:183337036-183337058 GGAATAAGGACTGCCTGGAAGGG + Intronic
918322851 1:183381326-183381348 GTTACAGGGACTGACTGGAAAGG - Intronic
922730199 1:227945581-227945603 CTCAAAAGCTCTGCCTGGCACGG - Intronic
1065377369 10:25057232-25057254 ATCAGAATGGCTGCCTGGAAAGG + Intronic
1067052116 10:43027715-43027737 GGCACAAGGCCAGCCTGGATGGG - Intergenic
1067474153 10:46555602-46555624 GTCACAAGCTGTGCCAGGAAAGG + Intergenic
1071727288 10:88212047-88212069 GGAACAAGGTTTGCCTGGCAGGG - Intergenic
1074738699 10:116463587-116463609 GTTACAAGATCAGCCTGTAATGG + Intronic
1076260052 10:129058196-129058218 GTCACAAGGTCCCTTTGGAAAGG + Intergenic
1079397465 11:20077543-20077565 GCCACAAGGTGAGCCTGGAGGGG - Exonic
1081919911 11:46764805-46764827 GTCACAAAGTCTGCCTTGTAAGG + Intronic
1083670116 11:64295134-64295156 GACACAGGGTCTGCCTTGGAGGG + Intronic
1084118301 11:67054582-67054604 GTCACACAGTCTGCCTGGCCAGG - Intergenic
1084175214 11:67419306-67419328 GTTACCAAGTCTGGCTGGAAAGG + Intronic
1084744864 11:71163327-71163349 GGCACAGGGTCTGCCTGTAATGG + Intronic
1088495082 11:110424362-110424384 CTCAAAAGGTCTGGCCGGAAGGG - Intergenic
1091113689 11:132994466-132994488 GGTACCAGGGCTGCCTGGAAAGG + Intronic
1091691355 12:2599590-2599612 CTCGCTAGCTCTGCCTGGAAGGG - Intronic
1098826022 12:75298191-75298213 GTCACAAGGATTCCCTAGAATGG - Intronic
1101408735 12:104452286-104452308 GGCACAAAGCCTGCCTGAAATGG + Intergenic
1114331116 14:21637954-21637976 TTTACCAAGTCTGCCTGGAAAGG - Intergenic
1114430625 14:22657403-22657425 GTCACAAAGTCTCCCCAGAATGG + Intergenic
1114667629 14:24389445-24389467 GTCACAAGGCCAGGCTAGAACGG + Intergenic
1119773997 14:77237367-77237389 GTCTCAGGGTCTGCTTGGATGGG - Intronic
1121014398 14:90539500-90539522 GCCACAAGTGCTGCCTGGCAGGG + Exonic
1122897375 14:104766781-104766803 AGCACAAGGCCGGCCTGGAAGGG - Intronic
1123921195 15:25070996-25071018 GTCACAGGGCCTCCCTGGCAGGG + Intergenic
1124432042 15:29616233-29616255 GTCCAAAGGTCTGCCTTAAAAGG - Intergenic
1127830273 15:62744157-62744179 GGCACAGAGTCTGCCTGAAAGGG - Intronic
1129385540 15:75194171-75194193 GCCACAAGGCCAGCCTGGGATGG - Intergenic
1130055573 15:80522222-80522244 GTCACAACAGCTGCATGGAAAGG + Intronic
1132294944 15:100727909-100727931 GTAACAGGGTGTGCCTGGCAGGG + Intergenic
1133399080 16:5471608-5471630 GTTACATGGTCTGCCTGGGAAGG + Intergenic
1136033799 16:27523023-27523045 GTCACAAGTTCAGCATTGAAAGG - Intronic
1138305639 16:55972023-55972045 GTGGCAAGGTCTGTCTGGATGGG + Intergenic
1139283604 16:65790724-65790746 GTCTCATGCTCTCCCTGGAATGG - Intergenic
1139967970 16:70756060-70756082 GTGACAAGGACTGCTTGGGAAGG + Intronic
1140487839 16:75308126-75308148 GCCACAAGTACTGCCTGGACAGG + Intronic
1141268547 16:82518802-82518824 GTCACAGGGCCTGCTTGGCAAGG + Intergenic
1142563299 17:824011-824033 GTCACAAGGTCTGTCTTCCAGGG + Intronic
1143323297 17:6081744-6081766 GTCACCAGGTCTGCCTGAAATGG + Intronic
1147187966 17:38722798-38722820 GCCCCTTGGTCTGCCTGGAAGGG + Intronic
1153343072 18:3995463-3995485 GGGACAAGCTCTTCCTGGAAAGG - Intronic
1157612061 18:48963407-48963429 GTCACAGGCTCTGGGTGGAATGG + Intergenic
1157812022 18:50704049-50704071 GTCACAAGGTCTGCCTGGAAAGG - Intronic
1160277478 18:77451222-77451244 GGCACAAGGTCTGCAGGGTAGGG - Intergenic
1160439470 18:78878385-78878407 GTGACAAGACCAGCCTGGAATGG - Intergenic
1161575957 19:5054550-5054572 GTCACATAGTCTGTCTGGGAGGG + Intronic
1165839743 19:38781147-38781169 GTCACCTGCTGTGCCTGGAAAGG - Intergenic
1166964555 19:46520854-46520876 GTCACGAGGCCTGCCCAGAATGG + Intronic
925750738 2:7089088-7089110 GCCACATGTTCTGCCTGCAAAGG - Intergenic
926412173 2:12615849-12615871 GTCACAAGGATTGCAAGGAATGG + Intergenic
929762149 2:44815433-44815455 GACAGAAGGTCTGGCTGGTATGG + Intergenic
933814319 2:86053385-86053407 GTTACAAGGTCTTCCTGAAGTGG + Intronic
937689447 2:124738440-124738462 GTATCAAGGTCTGCCGGGCAAGG + Intronic
948939340 2:241188271-241188293 CTTACGAGGTCTGCCTGGCAAGG + Intergenic
1168802201 20:650816-650838 GGCACAAGGCCTGCCTGGCACGG - Intronic
1170411064 20:16092433-16092455 GGCACAAGGCCTGCCTGGGCAGG - Intergenic
1171058730 20:21934522-21934544 GTCACAGGGGCTCCATGGAAGGG + Intergenic
1181487016 22:23237893-23237915 GTCATAAGGTTTTTCTGGAAAGG + Intronic
1182298592 22:29325762-29325784 GTGACAATGTCTGCCTTCAAGGG + Intergenic
1183713244 22:39519283-39519305 TTCACAGGGCCTGACTGGAAGGG + Intergenic
1184761756 22:46548923-46548945 GTCACAATGTCTGCCTTGTTGGG + Intergenic
950916148 3:16647205-16647227 GTGACAAAGTCTGTCTGGCATGG - Intronic
951497252 3:23343708-23343730 GGCACGAGGTCTCCTTGGAAAGG - Intronic
953432680 3:42852649-42852671 TACACAAAGTCTGGCTGGAAGGG - Intronic
954856719 3:53650122-53650144 GTCACAAGTTCAGCCGGGAGAGG + Intronic
955509293 3:59663352-59663374 GTGACAAGGTCAGCATGGAGTGG + Intergenic
958040705 3:88222454-88222476 GCCACCAGGTCTGTCTGGGAAGG - Intergenic
958843137 3:99232968-99232990 GTCACGAGAGCTCCCTGGAAGGG - Intergenic
959089574 3:101887748-101887770 GTCAGAGGGGCTGCTTGGAAAGG - Intergenic
962157754 3:132966475-132966497 CTCACAACTTCTCCCTGGAAGGG - Intergenic
968945837 4:3663747-3663769 GACGCAGGCTCTGCCTGGAAGGG - Intergenic
969084077 4:4642188-4642210 GTCACAAAGTCTGGCTGGAATGG + Intergenic
969512150 4:7624342-7624364 GAGACAAGGTCTGCATTGAATGG - Intronic
970804804 4:20018286-20018308 GTCACAAGGTCAGCTAGAAACGG - Intergenic
973289229 4:48453932-48453954 GTGATATGGTCTCCCTGGAAAGG + Intergenic
975174348 4:71270378-71270400 GTCACAGGTTCTGCCGGGCACGG - Intronic
975994958 4:80303029-80303051 GTCCCAAGCCCTGCCTGGCAGGG - Intronic
986578494 5:9237219-9237241 GACACATAGTCTTCCTGGAAAGG + Intronic
987372755 5:17208239-17208261 GCCACCATTTCTGCCTGGAAGGG - Intronic
989264112 5:39453211-39453233 GTCAGACGATCAGCCTGGAAGGG - Intronic
995243712 5:109913934-109913956 TTCAAAAGGTCTGCCTGGCAAGG - Intergenic
995911190 5:117189099-117189121 ATCACAAGGCATGCCTGGAGAGG + Intergenic
997299604 5:132792927-132792949 GGCACAAAGTCTGTATGGAATGG + Intronic
997360605 5:133292317-133292339 ACCACCAGGCCTGCCTGGAAGGG + Intronic
997868676 5:137487803-137487825 GTCATGAGGTTTTCCTGGAATGG - Intronic
999200351 5:149811978-149812000 GTCACCAGGTCTGGCGGGAGTGG - Intronic
1000793576 5:165636531-165636553 GACACAGAGTCTGCCTGTAAGGG + Intergenic
1001534610 5:172489852-172489874 GTCACAGGCTCTCCCTGGAGCGG + Intergenic
1002026098 5:176397223-176397245 GGTACAAGGTCTTCCAGGAAGGG - Intronic
1002332905 5:178457053-178457075 GGAACAAGGTGTGCATGGAAGGG - Intronic
1006130500 6:31866113-31866135 TTCACAAGGTGGGCCTGGGAGGG + Exonic
1006811368 6:36822428-36822450 GAGACTAGGTGTGCCTGGAAGGG + Intronic
1006941156 6:37753247-37753269 ATAAAAAGGGCTGCCTGGAAAGG - Intergenic
1007775375 6:44221990-44222012 GTCAGAAGATCTGCCAGGCATGG - Intronic
1007803272 6:44416389-44416411 GTCACCAGGGCTGCCTGTAAAGG + Intronic
1008177589 6:48287966-48287988 GTCACAAGTGCTGCCTGGCCTGG + Intergenic
1009836287 6:69005598-69005620 CTCACTAGGTCGGCCGGGAATGG - Intronic
1011001418 6:82592099-82592121 GTCACAAGGTCTCCATGGCCAGG - Intergenic
1014618626 6:123636982-123637004 GCCACAAGTGCTGCTTGGAAAGG - Exonic
1020209821 7:6150281-6150303 GGCAAACGGTCTTCCTGGAAAGG + Exonic
1024858872 7:53814463-53814485 GTCACAAAGTATGCATGAAAGGG - Intergenic
1025182760 7:56831960-56831982 GGCACAAGTTGGGCCTGGAATGG + Intergenic
1025689166 7:63745014-63745036 GGCACAAGTTGGGCCTGGAATGG - Intergenic
1026019104 7:66694432-66694454 AACATAAGGTCTGGCTGGAAAGG + Intronic
1028065927 7:86383883-86383905 GACACAAGGTTTGTCTAGAATGG - Intergenic
1028693223 7:93677455-93677477 GGCAGAAGGTCTGTCTGGACAGG + Intronic
1031066690 7:117113306-117113328 CTCATAAGGTTTGCCTGGGAAGG + Intronic
1032740647 7:134735041-134735063 GACACAAGGTCTTCCTGCATTGG - Intergenic
1036933334 8:12977271-12977293 ATCACAAGATCAGCCTGGAGAGG + Intronic
1040322656 8:46326478-46326500 CTCCCCAGGTCTTCCTGGAAGGG + Intergenic
1040560441 8:48518846-48518868 ATGACAATATCTGCCTGGAAAGG + Intergenic
1043714397 8:83463549-83463571 TTCACAAGCTCTGTCTGCAAGGG - Intergenic
1045475247 8:102547066-102547088 CTTGCAAGGTCAGCCTGGAATGG + Intergenic
1048496679 8:134941495-134941517 ATCTCAAGGTCTGCCTTGTAGGG - Intergenic
1048819540 8:138368188-138368210 GTCACAGCTTCTACCTGGAAGGG + Intronic
1052436161 9:28432116-28432138 GTGATTAGCTCTGCCTGGAAAGG + Intronic
1056800346 9:89686678-89686700 GCAGCAAGGTCTTCCTGGAAGGG - Intergenic
1058951842 9:109911128-109911150 GTCAGAAGGTGTGGCTGGATGGG + Intronic
1186835010 X:13428914-13428936 GTGAGAAGGTGAGCCTGGAAAGG - Intergenic
1189273112 X:39765631-39765653 GTCACGTGGGCTGCCCGGAAGGG - Intergenic
1193036898 X:76960990-76961012 GTGAAAAGGTCTGCCTGCAAAGG - Intergenic
1201148494 Y:11080956-11080978 GGCACAGGGTCTGCCTGTAATGG + Intergenic
1201533424 Y:15017849-15017871 GCCATAAGGTCTCACTGGAAGGG + Intergenic
1201764326 Y:17564613-17564635 GGCGCAGGGTCTGCCGGGAAGGG + Intergenic
1201837227 Y:18341377-18341399 GGCGCAGGGTCTGCCGGGAAGGG - Intergenic
1202170672 Y:22040479-22040501 GTGTCATGGTCTGCCAGGAAAGG + Intergenic
1202220691 Y:22545894-22545916 GTGTCATGGTCTGCCAGGAAAGG - Intergenic
1202322422 Y:23649769-23649791 GTGTCATGGTCTGCCAGGAAAGG + Intergenic