ID: 1157812176

View in Genome Browser
Species Human (GRCh38)
Location 18:50705088-50705110
Sequence ACCCATACCCCACACGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157812172_1157812176 17 Left 1157812172 18:50705048-50705070 CCACACGGTAGCATGAATAGCAT 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1157812176 18:50705088-50705110 ACCCATACCCCACACGGCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 93
1157812171_1157812176 24 Left 1157812171 18:50705041-50705063 CCGGCTTCCACACGGTAGCATGA 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1157812176 18:50705088-50705110 ACCCATACCCCACACGGCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157812176 Original CRISPR ACCCATACCCCACACGGCAG AGG Intronic
900382589 1:2392112-2392134 ACCCGTACCCCTCAGGGCCGCGG - Intronic
903025714 1:20428812-20428834 ACCCCTACCCCACCCAGCACAGG + Intergenic
903866665 1:26403835-26403857 ACACATCCCCCACAAGGCATAGG - Intergenic
905270249 1:36782944-36782966 GGCCATTCCCCACAAGGCAGGGG + Intergenic
905816247 1:40953170-40953192 ACCCAGACCCCACTCCGCAGTGG - Intergenic
906058941 1:42936058-42936080 ACGCATACCCCTCCTGGCAGTGG - Intronic
913699950 1:121364783-121364805 ACCCAAAACTCACAAGGCAGCGG - Intronic
914040497 1:144045225-144045247 ACCCAAAACTCACAAGGCAGCGG - Intergenic
914137590 1:144915254-144915276 ACCCAAAACTCACAAGGCAGCGG + Intronic
916056996 1:161074727-161074749 ACTCGTACCCCACTGGGCAGAGG + Exonic
916435435 1:164773669-164773691 AACCGTACCCCACACTGCATGGG + Intronic
916602742 1:166308801-166308823 ACCAATATCCCACACCACAGTGG + Intergenic
917975151 1:180233476-180233498 ACCCGTACCCAACACGGCCCCGG - Intronic
920487365 1:206383492-206383514 ACCCAAAACTCACAAGGCAGCGG - Intronic
920518161 1:206602040-206602062 GCCCAGAACCCCCACGGCAGAGG + Intronic
920851408 1:209630575-209630597 ACCCAGACCCTACAGGGGAGGGG + Intronic
921728284 1:218548669-218548691 AACAAAATCCCACACGGCAGTGG - Intergenic
1063212428 10:3893026-3893048 AGCCATCCCCGAGACGGCAGGGG - Intergenic
1069550445 10:69360450-69360472 AGCCATACCCTACAAGGCCGGGG - Intronic
1073365422 10:102936185-102936207 ACCCAAACGCCACTCCGCAGAGG - Intronic
1073457415 10:103645999-103646021 ACCCATACTTTACAGGGCAGTGG + Intronic
1083202795 11:61130672-61130694 CCCCAAACCCCACAGTGCAGGGG + Exonic
1084488534 11:69464849-69464871 ACCCATCACCCACTCAGCAGTGG - Intergenic
1086936555 11:92751581-92751603 AGCCATACCCCACAACCCAGTGG + Intronic
1087663916 11:101020012-101020034 ACCCTAACTCCACAGGGCAGAGG + Intergenic
1089629468 11:119775053-119775075 ACCCCTTCCTCACACTGCAGTGG + Intergenic
1091367870 11:135037358-135037380 ACCTACACCCCACCCTGCAGGGG + Intergenic
1091823648 12:3493541-3493563 ACCCAGACCCCGCGCGGCAGCGG - Intronic
1092164219 12:6333190-6333212 ACCCCCACCCCACAGGACAGAGG + Intronic
1098790923 12:74820735-74820757 ACCCCTACCTCACACTGCAGAGG - Intergenic
1101744247 12:107526426-107526448 ACCCAATCCCCACAGGGCTGTGG + Intronic
1107395446 13:40011868-40011890 AGGCATGCCCCACACAGCAGGGG + Intergenic
1113769783 13:112900660-112900682 ACCCATGCCCCTCACAGCAGAGG - Intronic
1121513832 14:94535721-94535743 ACACCTACCCCACAGGGCTGTGG - Intergenic
1126547717 15:49890858-49890880 AGCCACACCCCACATGGGAGTGG - Intronic
1128762279 15:70225465-70225487 CCCCATATCCCTCACAGCAGAGG - Intergenic
1129579215 15:76788165-76788187 ACCAAAACACCACACGGCCGTGG + Intronic
1129702497 15:77775841-77775863 CCCCAAACCCCACACAGCAGCGG + Intronic
1132662146 16:1066292-1066314 ATCCAGACCCCACGCGGCCGCGG - Intergenic
1132662170 16:1066374-1066396 ACCCAGACCCCACGCGGCCGCGG - Intergenic
1132856315 16:2046504-2046526 CCACATACCCCAGACTGCAGAGG - Intronic
1136036143 16:27542093-27542115 ACCCTGACCACACAAGGCAGAGG - Intronic
1136570397 16:31093409-31093431 ACCCCTGCCCCACCTGGCAGAGG + Exonic
1141573664 16:84950432-84950454 ACCCATTCCTCACAAGCCAGAGG + Intergenic
1148621983 17:49041686-49041708 ACCCCTGCCCCATATGGCAGTGG - Intronic
1148862626 17:50612569-50612591 ACACAGGCCCCCCACGGCAGAGG - Intronic
1150285172 17:63950152-63950174 CCCCAGACTCCACCCGGCAGGGG + Intronic
1152312300 17:79558680-79558702 ACCCAATCCCCGCAAGGCAGGGG - Intergenic
1152421151 17:80193867-80193889 CCCCATTCCCCACAGGACAGAGG + Intronic
1157370723 18:47109144-47109166 GCCCAGACCCCAGAGGGCAGAGG + Intronic
1157812176 18:50705088-50705110 ACCCATACCCCACACGGCAGAGG + Intronic
1158435170 18:57430324-57430346 ACCCAAACTCCTCACGGGAGGGG + Intergenic
1163118532 19:15201926-15201948 CCCCATACCCCACACAGCTTTGG + Intergenic
1164160445 19:22622962-22622984 ACCCCAACCCCAGACCGCAGGGG - Intergenic
932115368 2:69041928-69041950 ACCCAAACTCCACCAGGCAGAGG + Intronic
932571895 2:72942573-72942595 ACCCATGCCCCACTCTGCTGAGG - Exonic
941040694 2:160619604-160619626 TCCCATCCCCCACACCTCAGGGG - Intergenic
944243236 2:197506042-197506064 ACCCATTCCCCATACCACAGTGG - Intronic
948204971 2:236158894-236158916 ACCCTTCCCCCACAGGCCAGGGG + Intergenic
1174202731 20:48818646-48818668 ATCCATCCCCCACAGGGCAGAGG + Intronic
1175202722 20:57289330-57289352 ACCCACATCCCACAAAGCAGCGG + Intergenic
1175504458 20:59471670-59471692 CCCCACACCCCACAGGACAGAGG + Intergenic
1175588454 20:60166760-60166782 TCCCATACGCCAAATGGCAGAGG + Intergenic
1176064918 20:63189312-63189334 ACCCAGACCCCACCAGGCTGAGG + Intergenic
1177059846 21:16357479-16357501 ACACACACCCCACACGGCTGAGG - Intergenic
1180844216 22:18972679-18972701 ACCTAGACCCCACCTGGCAGAGG + Intergenic
1184218955 22:43086824-43086846 ACCCATTTCCCACCCAGCAGCGG + Intronic
1185343249 22:50300725-50300747 ACCCAGAGCCCAGACTGCAGGGG - Intronic
950559666 3:13714320-13714342 ACACATGCCCCACACCACAGTGG - Intergenic
954756785 3:52844914-52844936 ACCCAGGCTCCACACTGCAGAGG + Exonic
966432674 3:179848780-179848802 ACCCCTACCCCAAACTGCAAGGG - Intronic
967847576 3:194056496-194056518 ACCCACACAGCACACAGCAGGGG - Intergenic
969836857 4:9849242-9849264 ACCCATATCCCACTCTGCATCGG - Intronic
970293682 4:14604717-14604739 ACCCAAAACCCAGAGGGCAGAGG - Intergenic
971553553 4:27982590-27982612 ACCCATATCCCAAACACCAGAGG - Intergenic
976154086 4:82124103-82124125 ACACATACCCTAGAGGGCAGTGG + Intergenic
977358239 4:95973124-95973146 TCCCATTCACCACAGGGCAGTGG - Intergenic
984068642 4:175082603-175082625 ACCCATTCCCCACTCCCCAGCGG - Intergenic
984765097 4:183394289-183394311 ACCCACTCCCCACAGGCCAGCGG + Intergenic
984831260 4:183976634-183976656 ACTCATACCCCAAACCTCAGTGG + Intronic
988241288 5:28612548-28612570 ACCCTTACCCTACACCTCAGAGG + Intergenic
992875188 5:81047248-81047270 TCTCATACCCCACACGCCAAGGG - Intronic
999241183 5:150128345-150128367 ACCCATCCACCACAGGGCAGGGG + Intronic
999301233 5:150491888-150491910 ACCCGTACCCCAGACTGCATGGG + Intronic
1002312667 5:178324105-178324127 ACCCACACCCCTCACAGCACAGG - Intronic
1007231552 6:40351623-40351645 ATCCATACCCTACAAGGCATGGG - Intergenic
1012999602 6:106009018-106009040 ACACAGGCCCCTCACGGCAGTGG + Intergenic
1017421311 6:154275724-154275746 AGCTATACCCCATACAGCAGAGG + Intronic
1019950969 7:4372382-4372404 ACCCATACTCCACCCGCCAGTGG + Intergenic
1022603194 7:31781352-31781374 AACCAGATCCCACAGGGCAGAGG + Intronic
1024570786 7:50721687-50721709 ACCCATTCCCCACTGGGTAGGGG + Intronic
1030364570 7:108630727-108630749 AAACATACCACACACGGCAGAGG - Intergenic
1041169822 8:55129996-55130018 ACCCACACCCCACACCTCCGCGG - Intronic
1047498632 8:125426290-125426312 ATCCATCCCCCACACAGCTGTGG - Intergenic
1049219307 8:141421619-141421641 ACACAGGCCCCACACGTCAGAGG + Exonic
1057045108 9:91879523-91879545 ACCCATGTCCCCCACTGCAGAGG + Intronic
1057180925 9:93029806-93029828 CACCCTACCCCACACGGCAGTGG - Intronic
1059969533 9:119651073-119651095 CCCCAAACCCCCCAAGGCAGTGG - Intergenic
1062192463 9:135255029-135255051 GGCCACACCCCACACTGCAGGGG + Intergenic
1062482019 9:136756945-136756967 GCCCAGACCCCACGCTGCAGCGG + Intronic
1185513092 X:677628-677650 ACCCATGGCCCTCACAGCAGTGG - Intergenic
1189409625 X:40758599-40758621 ACCCAAACCCCAGCCTGCAGTGG + Intergenic
1190320968 X:49179004-49179026 AGACAAACCCCACACGACAGTGG + Intronic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic
1199654281 X:149979472-149979494 ACCCATCCCCCACATGACCGTGG + Intergenic
1200228677 X:154433164-154433186 AGCCAGACCCCACTTGGCAGAGG + Intronic