ID: 1157813800

View in Genome Browser
Species Human (GRCh38)
Location 18:50716853-50716875
Sequence CCGCTCTGTGTACAGGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157813800 Original CRISPR CCGCTCTGTGTACAGGGCAT GGG (reversed) Intronic
900476147 1:2877296-2877318 CCGCTCTGTGGACATGCCTTTGG + Intergenic
902985643 1:20152567-20152589 CCACTCTGGGTCCAGGGCAGAGG - Intergenic
904138688 1:28334562-28334584 ACGCTCTATGGACAGGGCAGGGG + Exonic
906522001 1:46472858-46472880 CCTCTCAGAGTACAGGGCCTAGG + Intergenic
909516885 1:76520424-76520446 CTGCTCTGAGGACAGGGAATTGG + Intronic
913183571 1:116345903-116345925 CAGGTCTGTGTTCTGGGCATGGG + Intergenic
917903968 1:179571657-179571679 CACCTCTGTGAGCAGGGCATAGG - Intronic
919946365 1:202321943-202321965 GTGCTCTGTGTGCAGTGCATTGG + Intergenic
1064420357 10:15185445-15185467 CCACTCTGTGTCCAGAACATGGG - Intergenic
1067047604 10:42993266-42993288 CCACTCTGTGTACATGGGGTGGG + Intergenic
1070995071 10:80771246-80771268 CAGCTCTCTGTGCAGGGCATAGG + Intergenic
1075065826 10:119288272-119288294 AAGGTCTGTGGACAGGGCATAGG + Intronic
1075133167 10:119758025-119758047 CAGCACTGAGTACAGGCCATGGG - Intronic
1077333656 11:1994150-1994172 CAGCTCTGTGCACTGGGAATGGG + Intergenic
1083120360 11:60506312-60506334 GCTCTCTGTGTACAGGGAAAAGG - Intronic
1085128228 11:74016549-74016571 TGGCTCTGTGTACAGGGCAGGGG + Intronic
1088875829 11:113935582-113935604 CTGCTCTGTGCACAGAGCCTAGG + Intronic
1089047460 11:115515593-115515615 TAGCACTGTGTAAAGGGCATGGG - Intergenic
1202816637 11_KI270721v1_random:49332-49354 CAGCTCTGTGCACTGGGAATGGG + Intergenic
1093676489 12:21946299-21946321 TGGCTCTGTGTCCAGGGCACTGG - Intergenic
1096458607 12:51808429-51808451 CTGCTCTGTGTCCAGTACATGGG + Exonic
1101204879 12:102476619-102476641 CCCTTCTGTGTATAGGGCACTGG + Intronic
1101763268 12:107676569-107676591 CCACTCTGTATACCAGGCATGGG + Intergenic
1102970358 12:117161501-117161523 CCGCTCTGTATGCAGGCCAGAGG - Intronic
1103298614 12:119909507-119909529 CTGCTCTGTGGACAGGGCCATGG - Intergenic
1104977282 12:132557835-132557857 CTTCTCTGGGTACAGGGCACGGG - Intronic
1111150592 13:84249284-84249306 CCTCTGTATGTACAGGGTATAGG - Intergenic
1111877808 13:93918677-93918699 CAGCTCTGTCAACAGGGCTTAGG + Intronic
1118952405 14:70446633-70446655 CAGCTGTTTGTGCAGGGCATGGG + Intergenic
1122238997 14:100349505-100349527 CCGCTGTGTGGCCTGGGCATGGG - Intronic
1123091068 14:105742536-105742558 CCCCTTTGTGTGCAGGGCCTGGG + Intergenic
1131610439 15:93955578-93955600 CCACTCTGTGTACATTGTATAGG + Intergenic
1131708054 15:95020104-95020126 CCACTCTGAGTACAAGGCAGAGG + Intergenic
1132120315 15:99170054-99170076 CTGCTAAGTGTTCAGGGCATTGG - Intronic
1135897354 16:26419771-26419793 CACCTCTGTGAGCAGGGCATAGG + Intergenic
1136628067 16:31473671-31473693 CCGCTCTGTAGACAGGGTCTGGG + Exonic
1140481048 16:75263089-75263111 CCGCCCTGTGTGCTGGGCACTGG - Intronic
1142371565 16:89685944-89685966 CTCCTCTGTGTTCAGGACATGGG - Intronic
1142617846 17:1146919-1146941 CTGCTCTGTGGCCAGGGCAGTGG - Intronic
1144460926 17:15458054-15458076 AGGCTCTGTGTGCAGGGCAAGGG + Intronic
1145272003 17:21409792-21409814 CATCACTGTGTGCAGGGCATGGG - Intronic
1145310209 17:21697255-21697277 CATCACTGTGTGCAGGGCATGGG - Intronic
1148535743 17:48437242-48437264 AAGCTCAGTGGACAGGGCATGGG + Intergenic
1151190542 17:72394804-72394826 CTGGTCTGTTTACAGGACATGGG - Intergenic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1153949894 18:10049574-10049596 ACAATCTGTGTGCAGGGCATTGG - Intergenic
1157813800 18:50716853-50716875 CCGCTCTGTGTACAGGGCATGGG - Intronic
1158362522 18:56690990-56691012 CCTCCCTGTGGACAGGGAATAGG - Intronic
1163636535 19:18439465-18439487 CCGCGCTTTGAGCAGGGCATCGG + Intergenic
928099778 2:28430032-28430054 CAGCTTTGTGCACAGGGGATAGG - Intergenic
935299611 2:101682521-101682543 CCACTCGGTGCACAGGACATGGG - Intergenic
947116639 2:226778704-226778726 CACCTATGTGTACTGGGCATTGG - Intronic
1170762769 20:19265358-19265380 AGGCTCTGTGTTCATGGCATGGG + Intronic
1173860042 20:46277378-46277400 CCTCTCTGTGGACACAGCATGGG + Intronic
1173926248 20:46783554-46783576 CAGCACTGTGTCCAGAGCATGGG - Intergenic
1176071850 20:63231080-63231102 CCTCTCCGTGTCCAGGGCTTAGG + Intergenic
1178454649 21:32737309-32737331 CCGCTAAGTGTACAAGGTATCGG + Exonic
1179309991 21:40186725-40186747 ACGCTCTGGGTGCAGGACATGGG + Intronic
1179962291 21:44775023-44775045 TCGCTCTGGGTACAGTGCAAAGG - Intronic
953922245 3:46960218-46960240 CCTCTCTGTGCACAGAGCCTGGG - Intronic
968492715 4:898942-898964 CAGCTCTGATAACAGGGCATGGG + Intronic
972635190 4:40877892-40877914 CAGCTCAGGGTACAGGGCATGGG + Intronic
973093317 4:46165308-46165330 TCTCTCTGTGTACTGGACATCGG + Intergenic
975619369 4:76280622-76280644 GAGGTCTATGTACAGGGCATGGG + Intronic
979238219 4:118425135-118425157 CCGGTCTGCGCACAGGGCAATGG - Intergenic
981937628 4:150252395-150252417 CCGCCCTGTGCCCAGGGCTTAGG + Intronic
982306216 4:153933884-153933906 CAGCTCTGGGTACAAGGCAAAGG + Intergenic
984275761 4:177607394-177607416 CCACTCTGAGTGCAGGGCCTCGG + Intergenic
990449998 5:55925015-55925037 TCGCTCTGTGTGCAGGACCTGGG + Intergenic
993647753 5:90480339-90480361 CTCCTCTGTGTACAGGGTAATGG + Intronic
999112895 5:149137388-149137410 CTGTTCTGTGTTCAGGGCCTGGG + Intergenic
1004354388 6:14918691-14918713 CCTCTGTGTGTACAGCGCTTGGG - Intergenic
1006990830 6:38213413-38213435 CCGCTCTGTGCTAAGGGCAATGG - Intronic
1008473672 6:51912512-51912534 CAGCACTGTGTCTAGGGCATGGG + Exonic
1010752305 6:79629418-79629440 CTGCTGTATGTACAGGGCTTGGG + Intergenic
1010890908 6:81309358-81309380 AGGCTCTGTGTACAGGGGAATGG - Intergenic
1011572834 6:88758334-88758356 CCTTTCTGTGTACCGGGCACTGG - Intronic
1013926622 6:115480667-115480689 CACCTCTGTGGGCAGGGCATAGG - Intergenic
1021939176 7:25662914-25662936 CCGCTCTCTATCCAGGGCAGAGG + Intergenic
1022471971 7:30687690-30687712 CCGCTCTGAGTGCAGCGGATAGG - Intronic
1023216795 7:37871144-37871166 CCCCTCTGCGTACAGAGCAGCGG + Intronic
1023912204 7:44564194-44564216 GCGCTCTGGGGCCAGGGCATTGG - Intergenic
1027702539 7:81486299-81486321 CAGCTGTGGGTACTGGGCATGGG - Intergenic
1029273090 7:99388527-99388549 CAGCTCCGTGGACTGGGCATCGG + Intronic
1029642694 7:101831118-101831140 CTGCTGTGTGAACAGGGCAGGGG + Intronic
1031867682 7:127056437-127056459 CCCTTCTGTGTACAGGCCCTGGG - Intronic
1033074444 7:138235352-138235374 GCTCTCTGTGCACAGGGCATGGG - Intergenic
1034338781 7:150339624-150339646 CCGCTCTGTGAGCACGGCCTGGG - Intronic
1044563531 8:93638098-93638120 CCACCCTTTCTACAGGGCATAGG + Intergenic
1045143512 8:99313746-99313768 CACCTCTGGGGACAGGGCATAGG - Intronic
1048657467 8:136556937-136556959 CCACTTTGTGGACAGAGCATTGG + Intergenic
1049326219 8:142022889-142022911 CTGCTCTGTCTTCAGGGCACAGG - Intergenic
1050054317 9:1636028-1636050 ACGCTCTGTCTGCAGGGAATGGG + Intergenic
1050082263 9:1927786-1927808 CCTCTCAGTGGACAGGGTATAGG + Intergenic
1054945260 9:70788991-70789013 CCAGTCTGTGGACAGGGGATTGG + Intronic
1056925750 9:90833173-90833195 CCACTCTGTGTGCAAGGGATGGG + Intronic
1060414371 9:123420265-123420287 CCGCTCTGTAGACAGGGAAAGGG + Intronic
1062130193 9:134888424-134888446 CCTCTCTGAGTAGAGGGTATAGG - Intergenic
1198413715 X:136397672-136397694 ACTGACTGTGTACAGGGCATGGG - Intronic
1199860227 X:151794789-151794811 CAGCTCTGTGCAGAGGGCTTGGG - Intergenic