ID: 1157815580

View in Genome Browser
Species Human (GRCh38)
Location 18:50727543-50727565
Sequence GCCGCAGGAACCACAGTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 112}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157815580_1157815590 20 Left 1157815580 18:50727543-50727565 CCCTTGACTGTGGTTCCTGCGGC 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1157815590 18:50727586-50727608 AGCCTGGAGGCAAAGAACATTGG 0: 1
1: 0
2: 0
3: 24
4: 263
1157815580_1157815583 4 Left 1157815580 18:50727543-50727565 CCCTTGACTGTGGTTCCTGCGGC 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1157815583 18:50727570-50727592 TCCCCTTCCTCCAGAGAGCCTGG 0: 1
1: 1
2: 7
3: 45
4: 369
1157815580_1157815593 27 Left 1157815580 18:50727543-50727565 CCCTTGACTGTGGTTCCTGCGGC 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1157815593 18:50727593-50727615 AGGCAAAGAACATTGGCTCAGGG 0: 1
1: 1
2: 0
3: 27
4: 310
1157815580_1157815587 7 Left 1157815580 18:50727543-50727565 CCCTTGACTGTGGTTCCTGCGGC 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1157815587 18:50727573-50727595 CCTTCCTCCAGAGAGCCTGGAGG 0: 1
1: 0
2: 5
3: 31
4: 356
1157815580_1157815592 26 Left 1157815580 18:50727543-50727565 CCCTTGACTGTGGTTCCTGCGGC 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1157815592 18:50727592-50727614 GAGGCAAAGAACATTGGCTCAGG 0: 1
1: 0
2: 1
3: 29
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157815580 Original CRISPR GCCGCAGGAACCACAGTCAA GGG (reversed) Intronic
900139214 1:1132454-1132476 GCCGCAGGCTCCTCAGACAAAGG - Intergenic
901841288 1:11955549-11955571 CCCCCAGAAACCACAGGCAAAGG - Intronic
904598697 1:31662265-31662287 GCCAGAGGAGCCAAAGTCAAGGG - Intronic
905623420 1:39469079-39469101 GCCACAGGAATTACAGGCAAAGG - Intronic
906700618 1:47855071-47855093 CCCACATGAACCACAGTCTAAGG - Intronic
919867687 1:201794556-201794578 GCCTCAGAAACCACACCCAAAGG + Exonic
921219983 1:212966693-212966715 GCAGCAGGAAAGACAGTCAAGGG + Intronic
922109177 1:222540783-222540805 GCCCCAGAGACCACAGTCATTGG - Intronic
1062870123 10:893993-894015 AGGGCAAGAACCACAGTCAATGG + Intronic
1063984660 10:11489733-11489755 GCCACAGGAACCACAGCTAATGG + Intronic
1064112355 10:12550120-12550142 GCAGCAGTGACCACAGCCAAGGG - Intronic
1069035822 10:63645123-63645145 GCTGGAGGAACCACGGTCAAGGG + Intergenic
1069458440 10:68572290-68572312 GGCGCAGGAAACAGAGTCATTGG - Exonic
1069684270 10:70307753-70307775 GCCTGAGGCACCACAGTCACTGG - Intronic
1070281414 10:75051548-75051570 GCTGCAGGCCCCACAGTCACTGG + Intronic
1073112885 10:101073304-101073326 GACTCAGGAACCCCAGTAAAAGG - Intergenic
1073847516 10:107575177-107575199 GTTGCAGTAACCACATTCAAAGG - Intergenic
1078664901 11:13316191-13316213 GCCACAGAAACCACAGTCCAGGG - Intronic
1081573342 11:44304565-44304587 GCCTCAGGCACCCCAGTCCAGGG + Intronic
1081746966 11:45480242-45480264 GCCAGAGGAACCATAGTTAAGGG - Intergenic
1083016806 11:59462582-59462604 GCCACTGAAACCAGAGTCAAAGG + Intergenic
1083420217 11:62548032-62548054 GCCAGAGGAACCACAGACATGGG + Intronic
1089844081 11:121444729-121444751 GGAGCAGGAACCACACTCCATGG + Intergenic
1092184643 12:6470121-6470143 GCCTCAGGAAAGACAGTCATGGG - Intronic
1095370982 12:41466960-41466982 GCAGCAGCAGCCACTGTCAAAGG - Intronic
1097456497 12:59804669-59804691 TCTGCAGGAACCACTGTCAAAGG - Intergenic
1099039911 12:77639659-77639681 GACAAAGGAACCACAGGCAAAGG + Intergenic
1103381448 12:120496830-120496852 GGCGCAGGAACCACACAGAAGGG - Intronic
1104201619 12:126595513-126595535 GCAGCTGGAACCACAGGCACGGG + Intergenic
1106242912 13:27924683-27924705 GCCGCAGGAACCACGATGAGAGG + Exonic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1121957962 14:98231289-98231311 GAGGCAGGAACAACAGACAAAGG + Intergenic
1123493275 15:20799608-20799630 TCCTCTGGAACCACAGTCCAGGG - Intergenic
1123549782 15:21368710-21368732 TCCTCTGGAACCACAGTCCAGGG - Intergenic
1125713798 15:41807511-41807533 TACACAGGAACCACAGTAAAGGG - Intronic
1128799459 15:70488360-70488382 GACTCTGGAACCACAGGCAATGG + Intergenic
1130360164 15:83176724-83176746 TCCGCAGGAACCACAGCAAGAGG - Intronic
1130936468 15:88475145-88475167 GCCACAGGAAGCAAAGGCAAGGG - Exonic
1202958113 15_KI270727v1_random:95928-95950 TCCTCTGGAACCACAGTCCAGGG - Intergenic
1132456202 16:24415-24437 CCAGCAGGCACCACAGTCTAAGG + Intergenic
1142118947 16:88376548-88376570 GCCGCGGGAACCCCAGCCAGCGG - Intergenic
1142297118 16:89231549-89231571 GCCTTAGGAACCCCAGTCCATGG - Exonic
1142846553 17:2681796-2681818 GCCGAAGGAGACACAATCAACGG - Exonic
1144776503 17:17787633-17787655 GCCGCAGGGCCCACAGTCCAGGG - Intronic
1148205090 17:45775062-45775084 GCCGCAAGGACCTCAGTCAAGGG + Intergenic
1154450830 18:14474146-14474168 TCCTCTGGAACCACAGTCCAGGG - Intergenic
1155471739 18:26199058-26199080 GCTGCAGGAACCACAAACGACGG - Intergenic
1157815580 18:50727543-50727565 GCCGCAGGAACCACAGTCAAGGG - Intronic
1161393741 19:4034135-4034157 GCATCAGGCACCACAGACAACGG - Intronic
1165733100 19:38158957-38158979 GCCTCAAAAACCACAGACAACGG - Intronic
936074465 2:109392936-109392958 GGCGAAGGAACCAGTGTCAAAGG + Intronic
939257751 2:139766345-139766367 GCAGCAGGAAACACACACAATGG - Intergenic
944131181 2:196349049-196349071 GCCGCAGGCACCACTGTAAGGGG - Intronic
944803444 2:203258578-203258600 TCAGCAGCAACCACAGGCAAAGG - Intronic
944886561 2:204068848-204068870 GTTGCAGGAACCACAGTGATGGG - Intergenic
944920382 2:204406679-204406701 TCAGCATGAACCACAGTGAATGG + Intergenic
946744078 2:222828643-222828665 GTAGCAGGAACCACAGGCACAGG + Intergenic
1171284826 20:23928502-23928524 CCAGCAGAAACCACAGTCTATGG + Intergenic
1171314804 20:24180273-24180295 GCTGCAGGAGCCACTGTCAAAGG - Intergenic
1174854153 20:54026966-54026988 GGCACAGGGACCACAGTGAAGGG - Intronic
1179588481 21:42389264-42389286 GGCCCAGGAACCACAGTGCAAGG + Intronic
1179678687 21:43002447-43002469 GGCACAGGAGGCACAGTCAATGG - Intronic
1179873945 21:44258141-44258163 CCGGCAGGAACCTCAGACAAAGG - Intronic
1180201091 21:46224733-46224755 GCCGCACAGGCCACAGTCAATGG + Intronic
1181052910 22:20246158-20246180 GGCTCAGGAGCCACAGTCAGGGG + Intronic
1183192290 22:36329367-36329389 GCGGCAGGAACCACAGCCTGGGG + Intronic
1183874797 22:40770739-40770761 GTGGCAGGAGCCAGAGTCAAGGG + Exonic
1185326628 22:50228788-50228810 GCTGCAGCAGCAACAGTCAAAGG + Intronic
950391966 3:12703807-12703829 GCAGGAGGAACCACACCCAAAGG + Intergenic
952604613 3:35130061-35130083 GCCTCAGGAAACACAGCCACGGG + Intergenic
953103744 3:39855488-39855510 GCCGCAGGAAGCCCCGTCCAAGG - Intronic
953386084 3:42506325-42506347 GCCAAAGGAGCCACAGTGAAGGG - Intronic
953663470 3:44907837-44907859 GGTACAGGAACCACAGCCAATGG - Intronic
955725780 3:61931101-61931123 GCTGCAGGAACCACAGCACATGG - Intronic
956468993 3:69545325-69545347 GCTGCAGGAACCACATCCAGAGG + Intergenic
956808293 3:72839271-72839293 GTAGCAGGAACTACAGTGAATGG - Intronic
960089091 3:113620839-113620861 GCCCCTGGAATCATAGTCAAAGG - Intronic
963264452 3:143227111-143227133 GCTGCAGGTACCACAGTAAAGGG - Intergenic
965144558 3:164884239-164884261 GCAGTTGGAACCACAGTCATGGG - Intergenic
969240627 4:5894651-5894673 GCCCCAGGATCCTCAGTCCATGG - Intergenic
969248552 4:5952503-5952525 GCCCCAGGCGGCACAGTCAAGGG + Intronic
969548639 4:7849066-7849088 GGCACAGGAACCACAGACAAAGG + Intronic
974528236 4:63073864-63073886 GCCATAGCAAACACAGTCAATGG + Intergenic
975822874 4:78289700-78289722 GCGGCAGGAACCAAAGTACAAGG - Intronic
977772187 4:100872792-100872814 GCCACAGGAACCCTAGTCAGAGG - Intronic
978750467 4:112240622-112240644 GCGGCAGGTACCAAAGGCAAGGG - Intronic
986448678 5:7845708-7845730 GCCGCAGGAACCATATTTTATGG + Intronic
991992242 5:72351581-72351603 GCCTCAGGAAATACAGTCATGGG + Intronic
993173464 5:84451752-84451774 GCTGCAGGAAACACAGTCCATGG + Intergenic
994301322 5:98151515-98151537 GCCACAGAGACCACACTCAATGG - Intergenic
999282978 5:150376891-150376913 GCCTCAGCAACCCCAGACAAGGG - Intronic
1004375872 6:15090213-15090235 GACCCAGGAAACAAAGTCAACGG - Intergenic
1005491632 6:26352738-26352760 GCCACAGGAACCAAAGTCACCGG + Intergenic
1007073619 6:39053364-39053386 CCAGCAGTAACCACAGCCAATGG - Intronic
1007151961 6:39702369-39702391 GCCGAAGGAATCTGAGTCAAGGG - Intronic
1007357122 6:41329112-41329134 GCCCCAGGATCCAAAGTCACTGG + Intergenic
1020173377 7:5863320-5863342 GCTGCATCAACCTCAGTCAATGG + Intergenic
1025804448 7:64817197-64817219 GCTTCAGGGACCACAGTAAAGGG + Intronic
1029085365 7:98007124-98007146 GCTGCATCAACCTCAGTCAATGG - Intergenic
1029344220 7:99966909-99966931 ACCACAGAAATCACAGTCAATGG - Exonic
1031881597 7:127204949-127204971 GCCTCAAGAACCACAGTTACAGG + Intronic
1033654122 7:143362036-143362058 GAGGCAGGAACGACAGTAAAAGG + Intronic
1034556896 7:151855759-151855781 GCGGCAGGAACCACAGGGATGGG + Intronic
1035299687 7:157888717-157888739 CCCACAGCAACCACGGTCAATGG + Intronic
1038535724 8:28351688-28351710 GCCGCAGGCACCCCAGTCCCTGG - Exonic
1046300617 8:112281314-112281336 AACCCAGGAACCACAGCCAATGG - Exonic
1047358316 8:124144279-124144301 GCCACAAGAACCCCAGTGAAAGG + Intergenic
1047957051 8:129984198-129984220 GCTGCAGGGACAACAGTCAGAGG + Intronic
1054173125 9:61857967-61857989 ACCGAAGGAACCACTGTGAAGGG - Intergenic
1054447979 9:65387009-65387031 ACCGAAGGAACCACTGTGAAGGG - Intergenic
1054664417 9:67722814-67722836 ACCGAAGGAACCACTGTGAAGGG + Intergenic
1056450226 9:86709617-86709639 GCCACAGGAGCAACAGTCATAGG - Intergenic
1056834543 9:89943839-89943861 CCAGCAGAAAACACAGTCAAGGG - Intergenic
1058665208 9:107307687-107307709 GACACAGAAACCACACTCAAAGG - Intronic
1058776828 9:108292797-108292819 GCCTCAGGAACCAAAACCAAAGG + Intergenic
1062237271 9:135516209-135516231 GCCGCAGGAAGGACACCCAAGGG - Intergenic
1189581860 X:42414676-42414698 GCCAAGGGAACCCCAGTCAAGGG - Intergenic
1190751400 X:53364876-53364898 GCATCAGGAACCACAGCTAAGGG + Intergenic
1190803806 X:53816208-53816230 GCAGGAGGAACCACAGCTAAGGG + Intergenic
1191813500 X:65217264-65217286 GCTGCAGGAACCACAGGCGTAGG + Intergenic
1197079284 X:122393287-122393309 AGCGCAGAAGCCACAGTCAAGGG + Intergenic
1198795861 X:140393407-140393429 GCAGCAGCAACTACCGTCAAGGG + Intergenic
1199868405 X:151874824-151874846 CCGGCAGCAAGCACAGTCAAAGG + Intergenic
1200209753 X:154342008-154342030 GCAGCAGGAGCGTCAGTCAAGGG + Intergenic
1200221099 X:154390084-154390106 GCAGCAGGAGCGTCAGTCAAGGG - Intronic