ID: 1157816022

View in Genome Browser
Species Human (GRCh38)
Location 18:50729893-50729915
Sequence CCCCCAGAGAAAGCCGGGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 215}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157816015_1157816022 -6 Left 1157816015 18:50729876-50729898 CCCCACAGAGCAGGAGACCCCCA 0: 1
1: 1
2: 3
3: 34
4: 352
Right 1157816022 18:50729893-50729915 CCCCCAGAGAAAGCCGGGGCTGG 0: 1
1: 0
2: 0
3: 24
4: 215
1157816012_1157816022 4 Left 1157816012 18:50729866-50729888 CCGCTCCAGGCCCCACAGAGCAG 0: 1
1: 0
2: 6
3: 43
4: 473
Right 1157816022 18:50729893-50729915 CCCCCAGAGAAAGCCGGGGCTGG 0: 1
1: 0
2: 0
3: 24
4: 215
1157816016_1157816022 -7 Left 1157816016 18:50729877-50729899 CCCACAGAGCAGGAGACCCCCAG 0: 1
1: 0
2: 1
3: 21
4: 281
Right 1157816022 18:50729893-50729915 CCCCCAGAGAAAGCCGGGGCTGG 0: 1
1: 0
2: 0
3: 24
4: 215
1157816014_1157816022 -1 Left 1157816014 18:50729871-50729893 CCAGGCCCCACAGAGCAGGAGAC 0: 1
1: 0
2: 4
3: 39
4: 347
Right 1157816022 18:50729893-50729915 CCCCCAGAGAAAGCCGGGGCTGG 0: 1
1: 0
2: 0
3: 24
4: 215
1157816017_1157816022 -8 Left 1157816017 18:50729878-50729900 CCACAGAGCAGGAGACCCCCAGA 0: 1
1: 1
2: 0
3: 44
4: 352
Right 1157816022 18:50729893-50729915 CCCCCAGAGAAAGCCGGGGCTGG 0: 1
1: 0
2: 0
3: 24
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157816022 Original CRISPR CCCCCAGAGAAAGCCGGGGC TGG Exonic
900131348 1:1088504-1088526 CCCCGAGAGAGACCCGGGGGAGG - Intronic
900176653 1:1294128-1294150 ACCAAAGAGACAGCCGGGGCCGG - Exonic
900233386 1:1574368-1574390 CCCTGAGAGGAAGCCGGGCCGGG - Intronic
900252883 1:1680579-1680601 CACCCACACAGAGCCGGGGCAGG - Intronic
900398772 1:2464299-2464321 GCCCCAGAGAAAGCCAAGGATGG - Intronic
902974755 1:20080753-20080775 CCCACAGAAGAGGCCGGGGCTGG - Intronic
902984070 1:20144715-20144737 CCCCCAGAGAAGGGAGTGGCTGG + Intronic
904612694 1:31734019-31734041 TCCGCAGAGACAGCCGGGGGAGG + Intronic
905173428 1:36122553-36122575 TCCCCAGAGAAGGCAGGTGCAGG - Intronic
912960107 1:114188559-114188581 CCTCCAGACACAGCAGGGGCAGG + Intergenic
915119168 1:153617765-153617787 CCACCAGAGGGAGCAGGGGCGGG - Intergenic
916752316 1:167734317-167734339 CCTCCATAGTAAGCCGAGGCAGG + Intronic
917500446 1:175580236-175580258 TCCCCAAAGAGAGCAGGGGCAGG + Intronic
918199953 1:182257696-182257718 CTCCAAGAGAAAGGAGGGGCAGG + Intergenic
920705828 1:208249738-208249760 CACCCCGAGAAAGCCCTGGCAGG - Intergenic
921432910 1:215083478-215083500 CTCCCAGAAAAGGCTGGGGCAGG - Intronic
922155947 1:223039661-223039683 CCCACAGAGACAGCTGGGCCAGG + Intergenic
922604514 1:226881144-226881166 CCCCCAGAGACAACTGTGGCAGG - Intronic
924624852 1:245689172-245689194 CCCCCAGAGCGAGCAGGTGCGGG - Intronic
1064354218 10:14603783-14603805 CAGGCAGACAAAGCCGGGGCCGG - Intronic
1067183398 10:44007113-44007135 CCCCCAGAGAAACCCCAGTCAGG + Intergenic
1067529423 10:47059713-47059735 CCCCGAGAGAATGCTGGAGCAGG + Intergenic
1069651788 10:70054033-70054055 CCCCCAAGGAAAGGCGGGGGAGG - Intronic
1071145453 10:82565086-82565108 CCGCCAGAGAAAGCAGCAGCAGG + Intronic
1072310507 10:94149827-94149849 CCTTCAGAGACAGCAGGGGCTGG + Intronic
1074591824 10:114821585-114821607 CGCCCTGAGAAAGCCGGGAGAGG + Intergenic
1075671901 10:124268731-124268753 CCACCAGTGAAAGCAAGGGCTGG + Intergenic
1075748246 10:124743243-124743265 CCCCAAGAGAAACCCTGAGCGGG + Intronic
1076886198 10:133263713-133263735 CCCCCAGTCAAACCCGGGGCTGG - Exonic
1078019973 11:7648727-7648749 CCCTCAGAGAAAGCTGTGTCTGG - Intronic
1078103936 11:8346543-8346565 GCCCAAGAGAAAGGTGGGGCAGG + Intergenic
1078668738 11:13346706-13346728 CCGCCAGAGAAAGCAGGGCATGG - Intronic
1083176000 11:60950956-60950978 CCGCCGGAGTATGCCGGGGCAGG + Intronic
1083459796 11:62803462-62803484 CCTCCAGAGAGAGGAGGGGCTGG - Exonic
1083784093 11:64933973-64933995 CCCCCAGTGAAAGCTGGGCTGGG - Exonic
1084384897 11:68837427-68837449 CCCCCTGAGTGAGCCAGGGCTGG + Intronic
1085299364 11:75449428-75449450 CCCCCAGGGAAAGCCCAGGTCGG + Intronic
1085732957 11:79014732-79014754 ACCACAGAGAAAGCCGGTTCTGG + Intronic
1090403845 11:126465776-126465798 CCCCAAGCCAAAGCCCGGGCAGG + Intronic
1090744606 11:129696040-129696062 CACTGAGAGGAAGCCGGGGCTGG + Intergenic
1091393758 12:141333-141355 CTCACAGAGAGAGCCCGGGCAGG - Intronic
1091681607 12:2531516-2531538 CTCCAAGAGAAAGACAGGGCTGG - Intronic
1091813825 12:3421309-3421331 AACCCAGAGGAAGCCGAGGCTGG - Intronic
1091823077 12:3490973-3490995 GGCCCAGAGAAAGCCGGCGCCGG - Intronic
1091828287 12:3531614-3531636 CACCAAGAGACAGCCAGGGCTGG + Intronic
1093736375 12:22625153-22625175 GCCGCAGAGCATGCCGGGGCTGG - Exonic
1094497098 12:30995275-30995297 CTCCCAGAGCAACCCTGGGCAGG + Exonic
1095716020 12:45346806-45346828 CCCCAAGAGAATGCCGTGGAGGG - Intronic
1096534152 12:52260110-52260132 CTCCCAGCTGAAGCCGGGGCAGG - Intronic
1097012931 12:55966107-55966129 CCCTCAGAGAAGGCCTGGGAGGG + Intronic
1097981891 12:65743735-65743757 CCTCCAGAGTAACCCGTGGCGGG + Intergenic
1099320733 12:81145210-81145232 CTCTCAGAGAAAACCTGGGCCGG - Intronic
1102453317 12:113056970-113056992 CCCCCAGCGGGAGCCGGGGGTGG - Intronic
1103327799 12:120133081-120133103 CCCACAGAGAAGGCTGGGGCTGG + Intronic
1103937059 12:124482428-124482450 CCCCGAGAGAAGGCCGAGTCTGG + Intronic
1104669019 12:130667717-130667739 CCCCCAGGGAGGGCGGGGGCTGG + Intronic
1104674783 12:130705087-130705109 CCCCCAGAGGCAGCCGGTGCTGG - Intronic
1104792439 12:131492579-131492601 CCTCCAGAAACAGCCGAGGCTGG - Intergenic
1104842986 12:131833519-131833541 CCCCCAGAGGAGGCCGGTGCAGG + Intronic
1104884814 12:132100520-132100542 CCCCCTGAGAAAGCCCAGCCTGG - Intronic
1104982011 12:132577366-132577388 CCTCCTGGGAAAGCGGGGGCTGG - Intronic
1108861286 13:54862512-54862534 ACCCCAGAGAAGGCAGTGGCAGG + Intergenic
1113913771 13:113857958-113857980 CCCTCAGAGGAGGCCGGGCCGGG + Intronic
1114193955 14:20461148-20461170 GCCCCAGGGTAAGCCGGGGCGGG - Exonic
1114340399 14:21736927-21736949 CGCTCAGGGAAACCCGGGGCAGG - Intergenic
1115627992 14:35214608-35214630 CCCCAAAACAAAGCTGGGGCCGG + Intronic
1116466782 14:45242613-45242635 CACTCAGAGAAAGACTGGGCAGG - Intronic
1117791173 14:59343696-59343718 GCTCCAGAGAAAGCTGTGGCAGG - Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1119785436 14:77310070-77310092 TCCCCACAGAAAGACTGGGCTGG + Intronic
1121439566 14:93940179-93940201 CCCCCAGAGAGAGCAGGGTCTGG - Intronic
1121491304 14:94363366-94363388 CACCCAGAGAGAGCCAGGCCAGG - Intergenic
1121494067 14:94379935-94379957 CACCCAGAGAAACACGGGGCTGG + Intronic
1121502383 14:94448504-94448526 CCCCAAGAGAGAGCAGGGCCAGG + Exonic
1122152211 14:99731350-99731372 CCCCCAGTGACTGCCGGGGAGGG - Intergenic
1122503494 14:102217232-102217254 CCTCCAGTGACAGCCCGGGCCGG + Intronic
1123986049 15:25647268-25647290 TCCCCACAGACAGCTGGGGCGGG - Intergenic
1124037542 15:26069694-26069716 GCCCCAGAAGAAGCCTGGGCAGG + Intergenic
1124605689 15:31168967-31168989 CACCCAGAGAAAGCCCAGGCTGG + Intergenic
1125038075 15:35150037-35150059 TCCTCAGAGAAAGCTGGTGCAGG - Intergenic
1125736383 15:41929290-41929312 CCCCCAGAGGAAGGAGGGACAGG - Intronic
1127417531 15:58771726-58771748 TCCCCGGAGACAGCCGTGGCCGG + Exonic
1128286220 15:66439116-66439138 CATCCAGAGGAAGCCAGGGCAGG - Intronic
1128452300 15:67812560-67812582 GCCCCTGAGACAGCCTGGGCTGG + Intergenic
1128807494 15:70541892-70541914 CCCACAAAGAAAGCCAGGGTAGG - Intergenic
1131512061 15:93054933-93054955 CCCCCTGATAAAGCCGGTACAGG + Intronic
1131629036 15:94156677-94156699 ACCCCAGAGAAATCCAGGGAAGG - Intergenic
1132152732 15:99474152-99474174 CAGCCACAGAAAGCCTGGGCAGG + Intergenic
1132518108 16:375278-375300 CCATCAGAGGAGGCCGGGGCGGG + Intronic
1133006282 16:2883423-2883445 ACCCCCGAGAGAGCCGGGCCGGG - Intronic
1135382969 16:22008932-22008954 CCACCAGAGGAAGCTGCGGCCGG + Intronic
1136110603 16:28062256-28062278 CCTCCAGAGGCAGCCTGGGCTGG - Intronic
1136387835 16:29941083-29941105 CCCCCAGAGAAGGCAGGAGTGGG + Intronic
1137618259 16:49859015-49859037 GCCCCCCAGAAAGCCTGGGCGGG - Intergenic
1139215191 16:65120838-65120860 TCCCCAGAGAAAGTGGGGTCGGG - Intronic
1139468473 16:67166243-67166265 CCCCCACAGAATGGCGAGGCTGG - Intronic
1139499094 16:67346123-67346145 CCCCGTGAGAAAGGCAGGGCTGG - Intronic
1142247627 16:88977099-88977121 CCCCGTGATAATGCCGGGGCCGG + Exonic
1143448954 17:7024314-7024336 CCCACAGAGAACGCCGAGCCAGG - Intronic
1144269319 17:13601636-13601658 GGACCAGAGAAAGCCGGGGCTGG - Exonic
1145298464 17:21613216-21613238 CCCCCAGAGACATACAGGGCAGG - Intergenic
1145839447 17:27982203-27982225 CCCTAAGAGATAGCTGGGGCAGG - Intergenic
1145904719 17:28509786-28509808 CCCCCTGAGAAAGCCTGCCCCGG - Intronic
1146940821 17:36843250-36843272 TCCCCAGACAAAGCAGGGACTGG - Intergenic
1147728601 17:42582349-42582371 CGCCCTGAGAAAGCCAGGGTGGG - Intronic
1148697157 17:49567547-49567569 CCTCCAGAGAGTGCCGGGCCTGG + Intergenic
1148895121 17:50835133-50835155 CCCCCACAAAGGGCCGGGGCCGG + Intronic
1149619103 17:58028600-58028622 CACCCAGAGAAGGCAGAGGCAGG + Intergenic
1151882545 17:76904053-76904075 ACCCCAGAGATGGCAGGGGCAGG - Intronic
1152305675 17:79519029-79519051 CACCAAGAGAAGCCCGGGGCTGG + Intergenic
1154297640 18:13164494-13164516 AGCCCAGAGAAAGCCTTGGCCGG + Intergenic
1157517504 18:48321273-48321295 CTCCCAGACAAAGCCCTGGCTGG + Intronic
1157816022 18:50729893-50729915 CCCCCAGAGAAAGCCGGGGCTGG + Exonic
1160095028 18:75863508-75863530 CCCCCAGAGAAAGGAGTGGAAGG + Intergenic
1160294381 18:77623922-77623944 CCCACCGAGAAAACCGGGGCTGG + Intergenic
1160513950 18:79468295-79468317 CCCACAAAGGAAGCCGGGGATGG - Intronic
1161058000 19:2200248-2200270 CCCCCAGACCAAGCCTGAGCGGG - Intronic
1161336158 19:3714741-3714763 GGCCCAGAGATAGCAGGGGCTGG - Intronic
1162800911 19:13109988-13110010 CCCCCACAGCAAGCAGGCGCTGG - Exonic
1162962239 19:14135380-14135402 CCCACAGAGAAAGGTGGGGAAGG + Intronic
1162964573 19:14149848-14149870 GCTCCGGAGAAAGCCCGGGCTGG + Exonic
1162968715 19:14167724-14167746 GCCCCAGAGAGAGCCAGGGTTGG + Intronic
1165291846 19:34891967-34891989 CCTCCAAAGGAAGCCTGGGCAGG - Intergenic
1165461353 19:35945907-35945929 GCCCCAGGGGAAGCTGGGGCAGG + Intergenic
1165939880 19:39409759-39409781 CGCCCAGAGCGAGCGGGGGCGGG + Intergenic
1166702676 19:44891309-44891331 CCGCCAGTGAGAACCGGGGCCGG + Exonic
1167232936 19:48296930-48296952 ACCCCACAGAGAGCCAGGGCAGG + Exonic
1167250629 19:48396775-48396797 ACCCCACAGACAGCCAGGGCGGG - Intronic
925284848 2:2709253-2709275 CCCCCAGAGTGCGCCGGTGCCGG + Intergenic
926138269 2:10352704-10352726 CCCCCAGGGAGAGCTGGGGAGGG + Intronic
926216899 2:10911571-10911593 CCACCAGGAAAAGCCGGCGCGGG + Intergenic
926311599 2:11679720-11679742 CGCACAGAGACTGCCGGGGCAGG - Intronic
926747248 2:16168959-16168981 CTCCGAGAGGAACCCGGGGCTGG + Intergenic
926762266 2:16288565-16288587 CCCCCTGAGAATCCCCGGGCTGG - Intergenic
929000561 2:37344181-37344203 CCCCCATAGAAAGCCTGGACTGG - Intergenic
930033460 2:47071905-47071927 CTCCCAGAGAGGGCCAGGGCCGG - Intronic
931720138 2:65061608-65061630 CCCACAGTGAAAGACAGGGCTGG + Intronic
932432559 2:71684712-71684734 CCCCCTCAGCAGGCCGGGGCCGG - Intronic
933816129 2:86070068-86070090 CCCCCAGAGTGAGCTGGGCCGGG - Exonic
934517245 2:94996425-94996447 CCGCTGGAGAAAGCCGGAGCTGG + Intergenic
934601834 2:95663783-95663805 GCCCCACATAAAGCCAGGGCCGG + Intergenic
935139388 2:100339313-100339335 CCCCCAAAGTAAGCTGGGTCCGG - Intergenic
936535185 2:113305938-113305960 GCCCCACACAAAGCCAGGGCCGG + Intergenic
937912430 2:127082048-127082070 GGCCCAGAGAAAGCCTGGCCGGG - Intronic
937913449 2:127087473-127087495 ACCCCAGAGGAAGCCAGGGTGGG + Intronic
938949587 2:136244251-136244273 CCCCCAGGGAGGGCCGGGGGTGG + Intergenic
948669412 2:239558505-239558527 CACCCTGAGAAAGCAGGGTCAGG - Intergenic
1170563575 20:17579582-17579604 CCCCCAAAAAAAGCAGTGGCAGG + Intronic
1171189731 20:23150607-23150629 CCCCCAGAGATCTCAGGGGCAGG + Intergenic
1172006417 20:31821665-31821687 CCCTCAGAGAAATCCGAGGTGGG + Exonic
1172656536 20:36541635-36541657 CCCCCCGTGACAGCCGGGTCGGG - Intronic
1172948014 20:38703522-38703544 CCCCCAGGAAAAGACGGGCCTGG - Intergenic
1172961859 20:38805739-38805761 CCCACAGACACAGCCGGGGTCGG + Exonic
1173904197 20:46613857-46613879 CCCTGAGAACAAGCCGGGGCAGG - Intronic
1174125069 20:48298280-48298302 CCCCCAGAGCAAGCCGGTGATGG + Intergenic
1174190279 20:48735487-48735509 CCCCCAGAGTGAGCTGGGGTGGG - Intronic
1175267497 20:57711351-57711373 AACTCAGAGAAAGCCGGTGCAGG + Intronic
1175859561 20:62143130-62143152 AGCCCAGAGAGGGCCGGGGCCGG - Intronic
1176071730 20:63230405-63230427 CTCCCAGAGGAATCTGGGGCTGG + Intergenic
1178599834 21:33985908-33985930 CCCCCAGCGGAAGCCAGGGAGGG - Intergenic
1179551215 21:42145287-42145309 CCCCCACAGAAAGCAGAGGGTGG - Intergenic
1182121264 22:27788407-27788429 CTTCCAGAGAAAGCAGGGGTTGG - Intronic
1182749403 22:32629509-32629531 CTGCCTGAGAAAGCCTGGGCTGG - Intronic
1183072128 22:35403452-35403474 CCTCCCCAGAAGGCCGGGGCCGG - Exonic
1184406944 22:44305712-44305734 CCCCCAAGGAAAGCCCAGGCTGG - Intronic
1184776479 22:46626005-46626027 CTCCCAGAGACAGCGGGGTCAGG - Intronic
1185315889 22:50178966-50178988 CCCACAGAGCCAGCCCGGGCAGG + Exonic
949360036 3:3221898-3221920 CACCCAGAGAAAGCCAGGGAAGG - Intergenic
949977848 3:9477130-9477152 CCCCCAGAGAAATGTGGGGCAGG - Exonic
950659115 3:14455720-14455742 CCTTCAGTGAAAGCCAGGGCAGG - Intronic
952901483 3:38114594-38114616 CCCCCAGGGAAACCCTGGCCTGG - Intronic
954187811 3:48932628-48932650 GCCCCAGACAAAGCCCAGGCAGG + Intronic
954714104 3:52518622-52518644 CCCCCAGAGCGAGGCTGGGCAGG + Intronic
957773932 3:84730711-84730733 TCCCAAGAGAAAGCCGGAGCAGG - Intergenic
961171714 3:124801979-124802001 CAGACAGAGAAAGCCGGGGTGGG - Intronic
961260074 3:125595283-125595305 CCCCGAGATACAGCCAGGGCCGG + Intergenic
961261057 3:125602271-125602293 GCCACAGAGAAACTCGGGGCAGG + Intergenic
961692494 3:128680339-128680361 CCCCAAAAAAAAGCCCGGGCTGG - Intronic
961769561 3:129239052-129239074 CACAAAGAGAAAGCTGGGGCTGG - Intergenic
962375201 3:134853291-134853313 CACCCAGAGAAAGCCAGAGGAGG + Intronic
965670206 3:171140332-171140354 ACCCCAGAGAAGGCTGGTGCTGG + Intronic
966912964 3:184569472-184569494 CCCACAGAGACAGGCGGGGAGGG - Intronic
968460287 4:721416-721438 TCCCCAGAGGAAGGCTGGGCTGG + Intronic
968508304 4:982538-982560 CCCCCAGTGAAAGGCGGACCTGG + Intronic
968532974 4:1104947-1104969 CCCCCAGGGAGAGCCTGGGCTGG + Intronic
968591127 4:1460153-1460175 TCCCCAGAGCAGGGCGGGGCTGG - Intergenic
971478550 4:27094286-27094308 TCCCCAGAGATGGCTGGGGCAGG + Intergenic
976053168 4:81031635-81031657 TCCCGGGAGAAAGCTGGGGCGGG - Intronic
976600557 4:86934748-86934770 CCCCCACAGCAGCCCGGGGCAGG + Intronic
979555221 4:122038836-122038858 CACCCAGAGAAAGGTGGGGTGGG - Intergenic
982265973 4:153538622-153538644 CCCTCAGGGCAAGCAGGGGCTGG + Intronic
985213908 4:187628853-187628875 ACCCCAGAGAAACCCAGTGCTGG + Intergenic
985548309 5:520867-520889 CCCCCAGAGGAAGCCCAGGAAGG + Intronic
985559196 5:573983-574005 GCCCCAGGGAGAGCCGGGCCTGG + Intergenic
985604423 5:850751-850773 CCCGCAGAGGGAGCAGGGGCTGG + Exonic
993457346 5:88141625-88141647 CGACTAAAGAAAGCCGGGGCGGG + Intergenic
996482147 5:123987963-123987985 CTCCCAGAGAAAGGAGGAGCAGG - Intergenic
998400862 5:141848474-141848496 TCCCCAGAGAAACCTGGGGCAGG + Intergenic
998406702 5:141878336-141878358 CGCCCAGAGCCAGCCGGAGCCGG - Exonic
999302642 5:150500675-150500697 CCCACAGGGAAAGCCTGGCCTGG + Intronic
1002061351 5:176627720-176627742 CACCCAGAGACAGGAGGGGCAGG + Intronic
1004537616 6:16518221-16518243 CCCCCATAGAAAGCTGGGGTGGG - Intronic
1005667991 6:28077434-28077456 ACCCCAGGGGAAGCCAGGGCTGG - Intergenic
1005674224 6:28137305-28137327 CCCCCGGAGAAAGGCGGGCTCGG + Intergenic
1006595829 6:35192125-35192147 CCCCCAAAGAAAGCCCAGGCTGG + Intergenic
1007816987 6:44531602-44531624 CTGCCAGGGAAAGCCGGGGCTGG + Intergenic
1012400899 6:98842584-98842606 TCCCGAGCGAAGGCCGGGGCTGG - Intergenic
1016385019 6:143522471-143522493 CCCCCAGAGGCAGGCAGGGCTGG - Intergenic
1017705536 6:157119403-157119425 CCAGCAAAGGAAGCCGGGGCTGG - Intronic
1018392241 6:163349537-163349559 CCCCCAGAGAGACCAGGGCCTGG - Intergenic
1018698901 6:166411999-166412021 CCCCCGGGGAAAGCCGAGACTGG + Exonic
1019423870 7:964022-964044 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1019423882 7:964055-964077 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1019423905 7:964121-964143 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1019434671 7:1015783-1015805 CCCACCGAGGAAGCCCGGGCTGG - Intronic
1019481195 7:1267577-1267599 CCCCCAGAGCAGCCCTGGGCTGG + Intergenic
1025854631 7:65266496-65266518 CCCCCAGAACAAGTGGGGGCTGG + Intergenic
1025968303 7:66296553-66296575 GCCCCAGAGAAAGAGGTGGCTGG + Intronic
1029267239 7:99352052-99352074 CCCCAAGAGAAAGCCAAGGGAGG - Intronic
1034964719 7:155384032-155384054 CCCCCAGAGAAGGCGGGCGTGGG - Intronic
1034979692 7:155467937-155467959 CCCTCCTAGAAAGCCGGGTCGGG - Intergenic
1035628496 8:1091143-1091165 CTCCCAGAGAGAACCGGGGTGGG - Intergenic
1041917887 8:63154180-63154202 ACCCCAGAGAAACCTGGGGTTGG - Intergenic
1046956744 8:120069926-120069948 CTCCCAGAGAAAGTCTGGGCTGG - Intronic
1049037286 8:140086503-140086525 CCCCCAGAGGCAGCAGGAGCTGG - Intronic
1049642547 8:143722077-143722099 CCTCCGGAGGAAGCCGGGGAGGG - Exonic
1049706933 8:144047399-144047421 CCCCCATACTAGGCCGGGGCTGG + Intergenic
1052892855 9:33720056-33720078 CACTGAGAGGAAGCCGGGGCTGG + Intergenic
1053087163 9:35235447-35235469 CCCACCAAAAAAGCCGGGGCGGG - Intronic
1059407163 9:114108402-114108424 GCCCGAGAGTAAGCCAGGGCAGG - Intergenic
1060583422 9:124771231-124771253 GGCCCAGAGAGAGCCGCGGCCGG - Exonic
1061133249 9:128719971-128719993 CACCGACAGAAAGCCGGGGTAGG - Exonic
1061743555 9:132724069-132724091 CCCTCAGAGAGGGCCTGGGCTGG + Intergenic
1062376757 9:136265285-136265307 CCCCCAGGGAAAGTCGGTGCTGG - Intergenic
1062564489 9:137158094-137158116 AACCCACAGAAAGCCGGGTCTGG + Intronic
1062697035 9:137880790-137880812 CCCACAGAGCAGGCCGAGGCTGG + Intronic
1185557022 X:1029654-1029676 CCTCTAGAGAAATCCGGGGCTGG - Intergenic
1189192498 X:39122642-39122664 CACCCAGAGAAAGCCTGAGAAGG + Intergenic
1190325399 X:49204264-49204286 CCCCGAGAGAAACCCAGAGCCGG + Intergenic
1190756307 X:53404942-53404964 CCCCCAGAGAAACCTAGGCCAGG + Intronic