ID: 1157816806

View in Genome Browser
Species Human (GRCh38)
Location 18:50735369-50735391
Sequence CAGAGCCTGCTAGTAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157816797_1157816806 27 Left 1157816797 18:50735319-50735341 CCCAGCCATGGTTGAGAAGTGTT No data
Right 1157816806 18:50735369-50735391 CAGAGCCTGCTAGTAGGCCTGGG No data
1157816800_1157816806 22 Left 1157816800 18:50735324-50735346 CCATGGTTGAGAAGTGTTGGTGT No data
Right 1157816806 18:50735369-50735391 CAGAGCCTGCTAGTAGGCCTGGG No data
1157816798_1157816806 26 Left 1157816798 18:50735320-50735342 CCAGCCATGGTTGAGAAGTGTTG No data
Right 1157816806 18:50735369-50735391 CAGAGCCTGCTAGTAGGCCTGGG No data
1157816803_1157816806 -5 Left 1157816803 18:50735351-50735373 CCAGTAGGGTCTTTGTGTCAGAG No data
Right 1157816806 18:50735369-50735391 CAGAGCCTGCTAGTAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157816806 Original CRISPR CAGAGCCTGCTAGTAGGCCT GGG Intergenic
No off target data available for this crispr