ID: 1157818897

View in Genome Browser
Species Human (GRCh38)
Location 18:50751140-50751162
Sequence GACCTGGATCTCCCGTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157818897_1157818898 -10 Left 1157818897 18:50751140-50751162 CCAGGAGACGGGAGATCCAGGTC No data
Right 1157818898 18:50751153-50751175 GATCCAGGTCTTAGTATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157818897 Original CRISPR GACCTGGATCTCCCGTCTCC TGG (reversed) Intergenic
No off target data available for this crispr