ID: 1157820064

View in Genome Browser
Species Human (GRCh38)
Location 18:50760631-50760653
Sequence AGCTGTACTCCCCTATTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157820064_1157820068 -7 Left 1157820064 18:50760631-50760653 CCTCCCAATAGGGGAGTACAGCT No data
Right 1157820068 18:50760647-50760669 TACAGCTCTCAGGCTACCCAAGG No data
1157820064_1157820076 26 Left 1157820064 18:50760631-50760653 CCTCCCAATAGGGGAGTACAGCT No data
Right 1157820076 18:50760680-50760702 CCAACCCTTCCCACTTCTGGTGG No data
1157820064_1157820073 23 Left 1157820064 18:50760631-50760653 CCTCCCAATAGGGGAGTACAGCT No data
Right 1157820073 18:50760677-50760699 CTCCCAACCCTTCCCACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157820064 Original CRISPR AGCTGTACTCCCCTATTGGG AGG (reversed) Intergenic
No off target data available for this crispr