ID: 1157824736

View in Genome Browser
Species Human (GRCh38)
Location 18:50802542-50802564
Sequence CAGGTAAACCAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 395}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157824736 Original CRISPR CAGGTAAACCAGAGGGAGGA GGG Intronic
900411087 1:2513020-2513042 CAGGTGAAGCAGCGGGAGAATGG - Exonic
900471953 1:2859453-2859475 GAGGAAGACAAGAGGGAGGAAGG + Intergenic
900565418 1:3329572-3329594 CAGGAAAACCAGGCAGAGGAAGG + Intronic
901403863 1:9032949-9032971 CAGGAATAGCAAAGGGAGGAAGG + Intergenic
901964979 1:12859194-12859216 CAGCGATACCAGAGGGAGGCAGG - Exonic
902005125 1:13225900-13225922 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902024350 1:13371694-13371716 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902416773 1:16244383-16244405 CAGGTAGGCCAGCTGGAGGATGG + Intergenic
903360530 1:22774190-22774212 CAGGAAACCCAGAGGAAGAAGGG - Intronic
903977081 1:27157441-27157463 GAGATAAGCCAGAGGGAGGAAGG + Intronic
904463118 1:30692274-30692296 AAGGAAGCCCAGAGGGAGGAGGG + Intergenic
905237369 1:36559369-36559391 CAGGTAAACCAAGTGGAGGTCGG - Intergenic
906146540 1:43563964-43563986 CAGGGAAACCCGAGGAAGGAGGG + Intronic
907005870 1:50912256-50912278 CAGGTAAATCTGATGTAGGAAGG - Intronic
907878109 1:58514910-58514932 TAGGTAAACCTGAGGGATGGAGG - Intronic
908151871 1:61310787-61310809 CAGGAAATTCAGAGGAAGGAAGG - Intronic
909609767 1:77539810-77539832 CAGTAAAACAACAGGGAGGAGGG - Intronic
909758592 1:79260596-79260618 GAGGTAGACCAGAATGAGGAAGG + Intergenic
910354701 1:86341448-86341470 CAGTTAAACCAGAGAGAAAAAGG - Intergenic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
910813555 1:91263943-91263965 TAGGTAAATCATAAGGAGGAAGG - Intronic
911477385 1:98390265-98390287 GTGGCAAACTAGAGGGAGGAAGG + Intergenic
912648774 1:111419844-111419866 AAGGTAAACCAAAGAGAGAATGG + Intronic
913115420 1:115692201-115692223 CAGGTAAAGCACAGGGAGAGAGG + Exonic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
914815727 1:151060551-151060573 CAGGTAAACCAAACTGAGGGAGG + Exonic
914830509 1:151167423-151167445 CGGGAAAGCCAGAGGTAGGAAGG + Intronic
914980892 1:152413419-152413441 CTGGAAAGCCAGAGAGAGGATGG + Intronic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
915724927 1:158010719-158010741 CAGGCAAAGGGGAGGGAGGAGGG - Intronic
916348371 1:163820478-163820500 CAGATAAGCCAGAGGGAGGAAGG + Intergenic
916392140 1:164342412-164342434 CTGGCAAAGCAGTGGGAGGAGGG - Intergenic
917871881 1:179249368-179249390 AAGGAAGACCAGAGGGAGCATGG + Intergenic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
919846794 1:201647853-201647875 CAGGTAAAAGAGACGGAGGGAGG - Intronic
920951290 1:210573913-210573935 CAGGGAAATGAGAGGGATGAAGG + Intronic
923621739 1:235585133-235585155 AAGGAAGACCAGAGGGAGGGAGG - Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
924809705 1:247390215-247390237 CAGGTTAAGAAGAGGAAGGAGGG - Intergenic
1063881679 10:10538254-10538276 CTGGCAGACCAGAGGGAGGCAGG - Intergenic
1064065840 10:12180861-12180883 TTGGTGAACTAGAGGGAGGAAGG - Intronic
1065821568 10:29530364-29530386 CAGGTGGGCCAGAGGCAGGAGGG + Intronic
1067396006 10:45918837-45918859 CAAGTAACCCATAAGGAGGAAGG - Intergenic
1067864325 10:49887955-49887977 CAAGTAACCCATAAGGAGGAAGG - Intronic
1067945152 10:50684492-50684514 CAGGTACCCCAGGGGCAGGAGGG + Intergenic
1069567817 10:69475118-69475140 AAAGAAAACCAGGGGGAGGAGGG + Intronic
1070055038 10:72926133-72926155 CAGCTTAACCAAAGGGAGAATGG + Intronic
1070325957 10:75389302-75389324 CTGGGAAACTAGAGGGAGTAAGG - Intergenic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070866658 10:79711364-79711386 CAGGTACCCCAGGGGCAGGAGGG + Exonic
1070880447 10:79849485-79849507 CAGGTACCCCAGGGGCAGGAGGG + Exonic
1071584996 10:86811456-86811478 CAGATAAATGAGAGGCAGGAAGG - Intronic
1071633569 10:87233587-87233609 CAGGTACCCCAGGGGCAGGAGGG + Exonic
1071647016 10:87365803-87365825 CAGGTACCCCAGGGGCAGGAGGG + Exonic
1072712381 10:97724414-97724436 CAGGGCCACGAGAGGGAGGAGGG - Intergenic
1074412040 10:113236633-113236655 CAGGTACACCAGAAAGGGGAGGG + Intergenic
1075111170 10:119585908-119585930 CAGGAAAACCAGAGTGTGGTAGG - Intronic
1075779459 10:125007517-125007539 CAGGTAGATCTCAGGGAGGATGG + Intronic
1076027774 10:127130443-127130465 CAGTTAAACTGGAGGGAAGAGGG + Intronic
1076090429 10:127680805-127680827 CAGGGAAGCCAGCTGGAGGAAGG + Intergenic
1076489261 10:130845878-130845900 TAGATACCCCAGAGGGAGGATGG + Intergenic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1077953811 11:6991356-6991378 TAGGGAAACCAGAGGCAGGGAGG - Intergenic
1078153394 11:8777838-8777860 CAGGTAGATTACAGGGAGGATGG - Intronic
1078328371 11:10398525-10398547 CAGGGAAATCAGGGGAAGGATGG + Intronic
1078427197 11:11261583-11261605 CAGGTAAACCAAAGGAAGGGAGG - Intergenic
1078707411 11:13758543-13758565 CAGCTAGATCAGAGGGAAGATGG - Intergenic
1080951263 11:37035851-37035873 CAGGAAATCCACAGGGAGAATGG + Intergenic
1081214579 11:40380170-40380192 CAATTAAACCTGAGGGAGTAGGG + Intronic
1081630843 11:44688558-44688580 GCGGGAAACCAGAGGGAAGAAGG + Intergenic
1081869770 11:46378026-46378048 CAGGGAAACGAGACAGAGGAAGG - Intronic
1083474011 11:62904032-62904054 CAGTTAAAGCAGAGAGAGGCCGG - Intergenic
1083674893 11:64319671-64319693 GGGGCAAACCAGAGGCAGGAAGG - Intronic
1084164003 11:67366751-67366773 CAGGGAAAGAAAAGGGAGGAGGG - Intronic
1084507240 11:69575918-69575940 CAGGTATTCCAGAGGTAGAAAGG + Intergenic
1084586476 11:70065575-70065597 CAGGCCAACTAGAGGGACGACGG - Intergenic
1085010498 11:73137694-73137716 CAGGTGAAAAAGTGGGAGGAAGG + Intronic
1085261285 11:75206167-75206189 CTGGGAAACAAGAGGGATGAAGG - Exonic
1085782536 11:79422737-79422759 CTGGTAGAACAGAGGGAGGGAGG + Intronic
1085875265 11:80399604-80399626 GAGGTAAAGCTGACGGAGGAGGG + Intergenic
1086205926 11:84258082-84258104 CAACTACACCAGAGGAAGGAGGG - Intronic
1086525410 11:87719629-87719651 TACCTAAAACAGAGGGAGGAGGG + Intergenic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1089369375 11:117944146-117944168 GAGGTAAACCAGAGAAAGGCAGG + Intergenic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1091113469 11:132993088-132993110 AAGGCAAACCAGTGGAAGGAGGG - Intronic
1091284779 11:134402521-134402543 CAGGTGTAACAGAGGGAGGTGGG - Intronic
1091534362 12:1391591-1391613 CAGGGAAAGCCGAGGGAGGCAGG - Intronic
1091770716 12:3149391-3149413 CAGGTAAAAAAGAGAGAAGAAGG - Intronic
1093224015 12:16459444-16459466 CAGGCTAACCAAAGGGAGAAAGG - Intronic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1097008130 12:55933347-55933369 CAGGGAAACCAGAGGAGGGAAGG + Intronic
1097920146 12:65063313-65063335 CACCTAAAATAGAGGGAGGATGG + Intronic
1098967881 12:76812288-76812310 CAGTTAAAGCAGAGTGATGATGG - Intronic
1100224617 12:92543531-92543553 CAAGTAATCCAGAGGGAATAAGG - Intergenic
1102605305 12:114063875-114063897 CCGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605354 12:114064019-114064041 CCGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605452 12:114064380-114064402 CCGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605462 12:114064416-114064438 CTGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605480 12:114064488-114064510 CCGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605498 12:114064560-114064582 CTGGTAAACCAGAGGGAGTCAGG - Intergenic
1103318765 12:120077951-120077973 GAGGGAAACCAGAGGGACGCAGG - Intronic
1103820053 12:123690519-123690541 CAGGGACACCTGAGGGAGAAGGG - Exonic
1106603040 13:31203402-31203424 CAGCTAAGCCAGTGGGAGGGAGG + Intronic
1107401974 13:40077970-40077992 CAGGTAGAAGAGAGGGAGGCAGG + Intergenic
1109002502 13:56824164-56824186 CAGGTATAAAAGATGGAGGAAGG - Intergenic
1110019529 13:70453080-70453102 CAGGAAAAAGAGAGAGAGGAGGG - Intergenic
1113372552 13:109736519-109736541 CACATAAACCAGAGACAGGAAGG + Intergenic
1114444039 14:22774320-22774342 CAGGTGGAGCAGAGGTAGGATGG + Intronic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118355249 14:65008402-65008424 CAGGGAAGCCAGAGTGAGCAAGG + Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1119081925 14:71702776-71702798 CAAATAAACAAGGGGGAGGAAGG - Intronic
1119480429 14:74954937-74954959 CAGGGAAGCCACAGGGAGGGAGG - Intronic
1120649557 14:87115421-87115443 CAGGGAAAGCAGAGGGAAAAGGG - Intergenic
1121399681 14:93662653-93662675 CAGGTAGGCCAGAGTGAAGACGG - Exonic
1121766782 14:96494708-96494730 CAGGTAGAGGGGAGGGAGGAGGG - Intergenic
1121882598 14:97514375-97514397 CAGGCAGGCAAGAGGGAGGAAGG - Intergenic
1122034587 14:98938131-98938153 CAGGTAAGCCTGAGACAGGAAGG + Intergenic
1122257001 14:100485703-100485725 CATGTGTTCCAGAGGGAGGAGGG + Intronic
1125832609 15:42727587-42727609 CAGGGAAGCCAAAGGGAGTAGGG + Intronic
1126789594 15:52209046-52209068 CAGGGAAACCTCAGAGAGGAAGG + Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1126988071 15:54337921-54337943 AAAGTAAAACAGAGGAAGGATGG - Intronic
1127588878 15:60402854-60402876 CAGGAAAACAGGATGGAGGAAGG - Intronic
1128064447 15:64755685-64755707 CAGCCACACCAGAGTGAGGAGGG + Intronic
1128686681 15:69691525-69691547 CATGTGAACCAGAGAGAGGATGG + Intergenic
1128762374 15:70226113-70226135 TAGGTAGACAAGAAGGAGGAGGG + Intergenic
1129107987 15:73322415-73322437 CAGTTAAACCTGAAGGAAGAAGG + Exonic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130338491 15:82978454-82978476 CAGGTAGACCAGAGTGGGGAGGG + Intronic
1130891443 15:88137118-88137140 CAGGTAACTCACAGGGAGAAAGG + Intronic
1131074488 15:89486722-89486744 CAGGTGAGCCTGAGGGAGGAGGG - Intronic
1131099127 15:89674220-89674242 CAAGTCGACCAGAGGAAGGATGG - Intronic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1132758161 16:1495998-1496020 CAGGGAAAACAGAGCGAGCATGG - Intronic
1133237816 16:4395876-4395898 CAGATTATCCAAAGGGAGGATGG + Intronic
1133392110 16:5418996-5419018 CAGGTAGGCCAGAGAGAGCAAGG + Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1135514022 16:23114240-23114262 CAGATAAGCCAGAGACAGGAAGG + Intronic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1135973874 16:27092797-27092819 CAGGTAACCCAGAGGAAGGCAGG + Intergenic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1139164407 16:64548987-64549009 CATGTAAAGAAGAGGGCGGAAGG - Intergenic
1139221163 16:65183676-65183698 CAGAGAAATCAGAGTGAGGATGG - Intergenic
1139800936 16:69522161-69522183 TAGGTGAAGAAGAGGGAGGAGGG + Intergenic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1141283119 16:82646800-82646822 CAATTAAGCCAGAGAGAGGAAGG + Intronic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1142008200 16:87700451-87700473 CAGATAAGGCGGAGGGAGGAGGG + Intronic
1142368778 16:89666123-89666145 CTGGAAAACCAGAGGCATGAGGG + Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1142905787 17:3040958-3040980 CAGGGAAACCAGAGAGAGCCAGG - Intergenic
1143520414 17:7441185-7441207 CAGCTCAACCAGAAGGGGGAAGG - Intronic
1143629597 17:8130460-8130482 CAGGAAAACCAGGGGGAGTGGGG + Intergenic
1143998346 17:11028973-11028995 CAAGAAAGCCAGTGGGAGGATGG + Intergenic
1144654289 17:17025407-17025429 GAGGTAGACCTGAGGGAGGGAGG + Intergenic
1146573827 17:33974875-33974897 CAGGAAAAGCTGAGGGATGAGGG - Intronic
1147187243 17:38719623-38719645 GAGGGACACCCGAGGGAGGAGGG + Intronic
1147319915 17:39639883-39639905 CAGAAAAGCCACAGGGAGGAGGG - Intronic
1147418665 17:40311223-40311245 GAGGGAAGCCAGTGGGAGGATGG + Intronic
1147720820 17:42538325-42538347 CAGGTACACCTGAGGAAGAAGGG - Exonic
1148801495 17:50229410-50229432 CAGGTAGGCCAGAGCGAGGTTGG - Intergenic
1149259664 17:54864953-54864975 AAGGAAAACCAGAGGGAGTTAGG - Intergenic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1151301967 17:73233005-73233027 CTGGTAACGCAGCGGGAGGAGGG + Intronic
1151471115 17:74318337-74318359 CCGGTACACCAGTGGGAGGCAGG + Intergenic
1151937312 17:77270522-77270544 CAGGAAAAACAGAGGGCTGAGGG - Intergenic
1152772555 17:82179241-82179263 CAGGAAAAGCAGAGGCACGATGG + Intronic
1153118415 18:1689801-1689823 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1154122474 18:11663127-11663149 CAGGTAACCAAGGAGGAGGAGGG + Intergenic
1156040915 18:32821958-32821980 AAGGTAAACCAAATTGAGGAAGG - Intergenic
1156297885 18:35809178-35809200 GTGGAAAACTAGAGGGAGGAAGG - Intergenic
1156409581 18:36815056-36815078 CAGGTACACCAGATGGAGGCTGG + Intronic
1157284884 18:46370882-46370904 CAGGTACACGAAAAGGAGGATGG + Intronic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158873197 18:61708851-61708873 CAGGTGAACTAGAGGGATGAAGG - Intergenic
1161220198 19:3114857-3114879 CACCCAAACCAGCGGGAGGACGG - Intronic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163668084 19:18612443-18612465 CAGGGAACGGAGAGGGAGGAAGG - Intronic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1165432937 19:35782677-35782699 CAGGTAAACCAGGAGGGGCAGGG + Exonic
1165896288 19:39143124-39143146 CAAGTAAACAAGTGGGAGAAGGG - Intronic
1166736001 19:45085251-45085273 CAGGTCACAAAGAGGGAGGAAGG - Intronic
1166978985 19:46621734-46621756 CTGGTAAGCAAGTGGGAGGAGGG - Intronic
1168106403 19:54168284-54168306 CAGGTAACCCTGTGGGGGGAAGG + Exonic
1168394644 19:56037834-56037856 CATGAAAACCTGAGGGAGGGAGG + Intronic
925302774 2:2828792-2828814 CAGGCAGACCAGAGGGAGACAGG + Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926973033 2:18485688-18485710 CAGGGAAACCTGGGGAAGGAGGG - Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
928189915 2:29154631-29154653 CAGGGAAATCATAGAGAGGAGGG + Intronic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
929609277 2:43257917-43257939 CAGAGAAGCCAGTGGGAGGAAGG + Intronic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
931049168 2:58390691-58390713 CAGGGAAAGCAGAGTTAGGAAGG - Intergenic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
933002286 2:76940475-76940497 CAGGTCTACCTGAGGGTGGAGGG + Intronic
933718179 2:85377386-85377408 CAGGTAGAGCAGATGCAGGAGGG - Exonic
934097913 2:88624682-88624704 CAGGACATCCAGAGGGAGGTAGG - Intronic
934928621 2:98400731-98400753 CAGGAAGATCAGAGAGAGGAAGG + Intergenic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936499860 2:113058684-113058706 CAGGAAAGACAGAGGAAGGAAGG + Intronic
936917869 2:117658685-117658707 CAGGTAGCCCAGATGGAGGAAGG + Intergenic
937067440 2:119028568-119028590 CAGGTAGATTAGAGAGAGGAAGG - Intergenic
937548909 2:123061762-123061784 CAGGCAAGCGAGAGAGAGGAGGG + Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938313585 2:130311269-130311291 CAGGGAATCCAGAGGGAGTGAGG - Intergenic
938381294 2:130837699-130837721 CAGGTGAGCCAGCGGGAGGGCGG + Intronic
940285721 2:152031525-152031547 CAGCACAACCTGAGGGAGGAAGG + Intronic
942320687 2:174733063-174733085 CATGGAACCCAGAGGGAAGACGG - Intergenic
944937578 2:204585136-204585158 CAAGAAAACAAGAGGGAAGAGGG - Intronic
945142969 2:206706716-206706738 AAGGTAAACCAAATCGAGGAGGG + Intronic
945417598 2:209594156-209594178 CAGGCATCCCAGAGGGAGTATGG + Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946332287 2:219017294-219017316 CAGGTAAAGCAGAGGCGCGAAGG + Intronic
946424509 2:219586018-219586040 CAGGTGGACTAGAGGGAGAAAGG + Intergenic
946777150 2:223155291-223155313 CAGGGAAACCATAGAGAGGGGGG - Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947705613 2:232273168-232273190 CAGGGAAACCCTAGGAAGGAGGG - Intronic
948493956 2:238333265-238333287 CAGGCCAACCAGAGGTTGGAGGG - Intronic
948870244 2:240794159-240794181 CAGGGAAGCCTGACGGAGGAAGG - Intronic
948885481 2:240880523-240880545 CAGGTAAGCCACAGAGAGGGAGG - Intergenic
1168918276 20:1509657-1509679 CAGGTAATCAAGATGGAGGTTGG - Intergenic
1169595291 20:7191637-7191659 CAGGTAAACCAGAACAAGGCAGG + Intergenic
1170907517 20:20529072-20529094 CACGGAAACTAGAGGGAGGCAGG + Intronic
1171240687 20:23565138-23565160 CAGGTCAAGCAGTGGGAAGACGG + Intronic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171543052 20:25979218-25979240 CAGGTGCACCAGAAGGTGGAGGG - Intergenic
1172408011 20:34703857-34703879 GAGGTGAGCCAGAGGGGGGAGGG + Intronic
1172477800 20:35252059-35252081 CAGGAAAAACAGAGTGAGGGTGG - Intronic
1172900928 20:38334408-38334430 CCTGGAAATCAGAGGGAGGATGG - Exonic
1173260844 20:41433983-41434005 CATGTAAACCAGAGGAAGGCAGG + Intronic
1173574266 20:44100535-44100557 CAGGTAGACCAGGGGAAGGGAGG + Intergenic
1174393292 20:50231398-50231420 CAGGCAGAACAGTGGGAGGAAGG + Intergenic
1174438100 20:50526415-50526437 CAGGTAAACTAAGGGGAGTAGGG - Intronic
1175294679 20:57900241-57900263 GAGGGAAACGAGTGGGAGGAAGG - Intergenic
1175605197 20:60307091-60307113 AAAGCAAACCAGAGGGAGCAGGG + Intergenic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1178436171 21:32560297-32560319 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1179229543 21:39489037-39489059 CAAGAAGACCAGAGGGAAGAAGG + Intronic
1180965185 22:19784484-19784506 CAGGTAACACGCAGGGAGGAAGG + Exonic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181527342 22:23497569-23497591 GAGGGCATCCAGAGGGAGGAGGG - Intergenic
1181711828 22:24696064-24696086 CAGGCACCCCAGAGGGAGGGAGG - Intergenic
1182282281 22:29224538-29224560 AATGAAAACCAGAGGGAGGCTGG - Intronic
1182661720 22:31929776-31929798 CTGGTCTACCAGCGGGAGGATGG - Intergenic
1182796671 22:32995992-32996014 CAGCTGCACCAGAAGGAGGAGGG + Intronic
1183002033 22:34868578-34868600 CAGGTGAAGCAGAGGGAGTGAGG - Intergenic
1183467670 22:37987819-37987841 CAGGGAAACTGGAGGTAGGAGGG - Intronic
1184478306 22:44733476-44733498 CAGGGCAACCAGAGCAAGGAAGG + Intronic
1184563418 22:45276612-45276634 CAGGTAAGACACAGGGAGTAGGG - Intergenic
1185258742 22:49850043-49850065 AAGGGAAACCACAGGCAGGAGGG - Intergenic
1185290584 22:50024538-50024560 CAAGTAATTCAGTGGGAGGAAGG + Intronic
1185320981 22:50200237-50200259 AAGGGAAACCACAGGCAGGAGGG + Intergenic
949165325 3:933670-933692 GAGTTAAAGGAGAGGGAGGATGG + Intergenic
949205480 3:1433175-1433197 CAGGAAAAACAGAGAGAGGGAGG - Intergenic
949729933 3:7097152-7097174 CAGGTAAAGCAGATGGAGAGTGG + Intronic
950161952 3:10766894-10766916 CAGATAAACCACAGGGAAGCAGG - Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
951666132 3:25125932-25125954 CAGGAAAACCAGACTGAGGGTGG + Intergenic
952655073 3:35776420-35776442 CAGGGAAAGCAGAGGAAGGGTGG + Intronic
953850105 3:46459553-46459575 CAGGTGAAGCAGAGGAAGTAAGG + Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955636221 3:61032543-61032565 CAGCAAAACCAGAAGGAGCAGGG + Intronic
956181941 3:66525291-66525313 CAGGTAAAGAAGAGCCAGGAGGG - Intergenic
956578976 3:70788757-70788779 CAGGTAACCCATAGGAAGGCAGG - Intergenic
956776866 3:72572401-72572423 CAGGGAGACCAGAGCCAGGAGGG - Intergenic
957761435 3:84562634-84562656 CAAGTAAACAAGAGGGAGAACGG - Intergenic
958659934 3:97053525-97053547 CAGGTAAACTATAGAGAGTAAGG + Intronic
958885393 3:99721006-99721028 CAGGTGAACCAAAGGAAAGAAGG + Intronic
960630413 3:119725153-119725175 CAGGTAAAGGAAAGGGAGGCTGG - Intronic
960701989 3:120448682-120448704 CAGGCAAACTACAGGGAAGAAGG - Intronic
961742266 3:129040242-129040264 CAGGCATGCCAGTGGGAGGAAGG - Exonic
961884462 3:130087078-130087100 CCGGTTAACCAGAGCGAGTATGG + Intronic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963654266 3:148025222-148025244 GAGATAGACCAAAGGGAGGAGGG + Intergenic
964782236 3:160352930-160352952 GAGGTACACTAGAGGCAGGATGG - Intronic
965084505 3:164077476-164077498 CAGGGAAAGCAGAGGGAAAAAGG + Intergenic
966442123 3:179957344-179957366 CAGGTAAGGCTCAGGGAGGAAGG + Intronic
968929944 4:3573530-3573552 CATGAAAACCAGAGTGAGAAGGG + Intergenic
969058026 4:4414132-4414154 CAGGTTCCCCACAGGGAGGAGGG + Intronic
969117569 4:4881209-4881231 CAGGACAACCAGTGGTAGGAGGG - Intergenic
969828718 4:9778736-9778758 CAGATAGAGCAGAGGGAGAAAGG + Intronic
970327078 4:14936932-14936954 CAGGTACAGCTGAGGGAAGAGGG + Intergenic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
970560054 4:17273945-17273967 CAGCCAAACCAGTGGGAGAAGGG - Intergenic
972578722 4:40375954-40375976 AAAGAAAACCAGAGAGAGGAAGG - Intergenic
972770620 4:42193877-42193899 TGGGTAAAGCAGAGGGAAGATGG + Intergenic
973178374 4:47236683-47236705 CAGGTAAAACAAAGGCAGAAAGG + Intronic
973284122 4:48396262-48396284 AAGGTAAAGAAGGGGGAGGAGGG + Intronic
973581611 4:52349550-52349572 CAGGTGGACTAGAGGGAGAAAGG + Intergenic
973624658 4:52759324-52759346 CAGGTCAACTAGAGCAAGGATGG - Intergenic
977128243 4:93198501-93198523 CAGCTGAACCAGAGGGACTAAGG + Intronic
977724707 4:100282379-100282401 CAGGTAAACGATGGGGAGGATGG + Intergenic
978940900 4:114434954-114434976 CTGGCAAAGCAGAGTGAGGAAGG + Intergenic
981193679 4:141893063-141893085 CAGGAAGACTAAAGGGAGGAGGG + Intergenic
981269543 4:142829015-142829037 TAGGTAGATCAGAGGGAGGAGGG + Intronic
981269567 4:142829335-142829357 CAGGTAGATCAGAGGGAGGAGGG + Intronic
984097431 4:175449624-175449646 CAGCTGGACCAGAGGGAGAAAGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985132249 4:186750455-186750477 CAGGAAAACCAGATAGTGGATGG + Intergenic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
986054323 5:4120881-4120903 GAGGTCTACCAGAGGGTGGATGG + Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
987185647 5:15415651-15415673 AAGGAAGACAAGAGGGAGGACGG + Intergenic
988717377 5:33841386-33841408 GAGGTTAACCAGAGACAGGATGG - Intronic
989093927 5:37763556-37763578 CAGGAAAAGCAGAGGAAGAAGGG + Intergenic
989236724 5:39156426-39156448 CAGCAAAACCAGAGGGAAGCAGG + Intronic
989665227 5:43846301-43846323 AAGGAAAAAGAGAGGGAGGAAGG - Intergenic
991601084 5:68351775-68351797 CTGGAAGACCAGAGGTAGGAAGG - Intergenic
992640564 5:78765327-78765349 CTGGGAAATCAGTGGGAGGATGG + Intronic
992868009 5:80977166-80977188 CAGGTAAACAGGAAGGAGGATGG - Intronic
992950261 5:81851310-81851332 GAGGTGGATCAGAGGGAGGAAGG + Intergenic
994636003 5:102344876-102344898 CAGGTGGACTAGAGGGAGAAAGG + Intergenic
994976780 5:106818379-106818401 CAGGTAAAGAAGGAGGAGGAAGG - Intergenic
997195253 5:131974911-131974933 CATGTGAGCCAGAGGCAGGAAGG + Exonic
997665319 5:135625718-135625740 CAGGTAGAACAGGGGGAAGAAGG + Intergenic
998779351 5:145639340-145639362 CTTGAAAACCAGAGGGAGAAGGG + Intronic
999296533 5:150462947-150462969 GAGGAGAACCAGAGGGAGAAGGG + Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000297445 5:159924445-159924467 GAGGAAAACGGGAGGGAGGAAGG + Intronic
1000389536 5:160708807-160708829 CAGATAAATCAGAGTCAGGATGG - Intronic
1001344231 5:170876232-170876254 GGGGTAACCCACAGGGAGGAGGG - Intronic
1001573096 5:172743682-172743704 CAGGTGGTCCAGAGGAAGGAGGG + Intergenic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1002980214 6:2128630-2128652 CAGGTAGAGGAGTGGGAGGAAGG - Intronic
1003024461 6:2541941-2541963 GAGGCAAACCAGAGGGAGATGGG + Intergenic
1003034634 6:2632277-2632299 CAGAAAAATCAGAGGGAGGTGGG + Intronic
1003482407 6:6545994-6546016 CAGGAAAGGCTGAGGGAGGAAGG - Intergenic
1004206710 6:13598253-13598275 AAGGTAACCCTGAGGTAGGAGGG + Intronic
1004673943 6:17823437-17823459 AAGGAAAAAGAGAGGGAGGAAGG - Intronic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1007143072 6:39596147-39596169 CAGGTCAACCAGATGGAGTTTGG + Exonic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007403061 6:41615586-41615608 CAGCTAATCCAGAGGGAGGAGGG + Intergenic
1007983625 6:46185305-46185327 CAGGCAGAGCTGAGGGAGGAAGG - Intergenic
1008627843 6:53335332-53335354 CAGGGAAGCCAGAGGGAGACAGG - Intronic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012542063 6:100372664-100372686 CAGGAAAGCCACACGGAGGATGG + Intergenic
1013000880 6:106020943-106020965 CAGGTAGACAAGAGGGGGAAAGG - Intergenic
1013680375 6:112518884-112518906 CAGGGAAAGCAGAGGAAGAAAGG + Intergenic
1014885009 6:126769334-126769356 CAGGTAATGCTGAGGGAGGGTGG - Intergenic
1016625159 6:146158279-146158301 GAAGGAAACAAGAGGGAGGATGG + Intronic
1017348896 6:153416492-153416514 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1017631225 6:156397757-156397779 CTGCTAGCCCAGAGGGAGGAAGG + Intergenic
1017929302 6:158938494-158938516 CAGGTGAAAAGGAGGGAGGAAGG + Intergenic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018561960 6:165109526-165109548 AAGATAAACAAGAGGGATGAAGG - Intergenic
1018614431 6:165673180-165673202 CAGATAAACTAGATGGAAGAAGG + Intronic
1019210662 6:170401992-170402014 CAGGGAGTCCTGAGGGAGGATGG - Intronic
1021281694 7:18727693-18727715 GAGGTAAAACAGAGGCAGCAGGG - Exonic
1021505957 7:21385349-21385371 CAGGTATAACAGAGGGAGGCAGG - Intergenic
1022406145 7:30092299-30092321 CAGGTAAACTCCAGGCAGGATGG - Intronic
1023067292 7:36390247-36390269 CAGATAAAACTCAGGGAGGAAGG + Intronic
1023119984 7:36899407-36899429 CAGGTGAAGAAGAGGGAGAAGGG + Intronic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024985656 7:55191377-55191399 CAGATAAACCACATGCAGGAAGG + Intronic
1026822079 7:73556855-73556877 CAGGGAAATTAGAGGGAGGCTGG + Intronic
1026889857 7:73975361-73975383 CAGGCAAACAATAGGGAAGACGG - Intergenic
1026979680 7:74519087-74519109 CAGGCAATGCAGAGGCAGGAAGG + Intronic
1031460928 7:122047730-122047752 CAGTTAAGCCAGGGAGAGGAAGG - Intronic
1032325308 7:130922582-130922604 CAGGAAAACCACAGGCTGGAGGG + Intergenic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1033021149 7:137725426-137725448 AAGGAAAACCAAAGGGAGAATGG - Intronic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1034423721 7:151002126-151002148 CAGGGAGGCCAGAGTGAGGAGGG + Intronic
1035100069 7:156389244-156389266 CAGGGACACCAGCTGGAGGAAGG - Intergenic
1035776121 8:2190090-2190112 CAAGTAAAGAAGTGGGAGGAAGG + Intergenic
1037522486 8:19693360-19693382 CTGGTAGAACAGAGAGAGGATGG - Intronic
1037937166 8:22922781-22922803 CAGGTAAACCACAAGCAGCAAGG - Intronic
1038283977 8:26190471-26190493 CGGGTAGAGCAGCGGGAGGAGGG - Intergenic
1039115474 8:34087573-34087595 CAGGTTAACTACAGGGAGAAAGG - Intergenic
1039407544 8:37326286-37326308 GAGGGAAGCCAGTGGGAGGAAGG - Intergenic
1039736281 8:40336313-40336335 CATGTAAAACAGAGAGAGGCAGG - Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1040435043 8:47381913-47381935 CTGGTAGAACAAAGGGAGGATGG - Intronic
1040915274 8:52562557-52562579 CAGGAAACCCTGAGGCAGGAGGG - Intronic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1043269300 8:78309822-78309844 CAGGTAAGGGAGTGGGAGGAGGG - Intergenic
1044627852 8:94251811-94251833 CAGGTAGACCAGATGGACAAGGG + Intronic
1045674098 8:104589082-104589104 CAGGCGAGCCGGAGGGAGGAGGG - Intergenic
1047421222 8:124709910-124709932 CAGCTAAACCAGAGGGTAGGTGG - Intronic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1049879760 8:145053558-145053580 CAGGGAAGCCTGAGGGAGCAGGG + Intronic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050259649 9:3828061-3828083 CAGGAAAACCAGAGAGAAAAAGG + Exonic
1052352094 9:27468466-27468488 CTGGTAAAGCAGAGGGAACAAGG + Intronic
1054460336 9:65458941-65458963 CATGAAAACCAGAGTGAGAAGGG - Intergenic
1055990918 9:82104838-82104860 CAGGTAAAACTGTGGCAGGAAGG + Intergenic
1056292533 9:85158097-85158119 GAGCTAAACCACAGGGAGGGAGG - Intergenic
1056408387 9:86299062-86299084 CAGGTCAGCCAGAGGAAGGAGGG + Intronic
1056633408 9:88312335-88312357 CAGGTAAATAACAGGAAGGAAGG - Intergenic
1056751737 9:89356931-89356953 CTGGTGCACCAGAGAGAGGATGG - Intronic
1057292356 9:93814717-93814739 CAGGGAAACCAGAGAGAGAGAGG - Intergenic
1057353780 9:94319565-94319587 CAGGTACTCCAGGGGCAGGAGGG - Intronic
1057653970 9:96938027-96938049 CAGGTACTCCAGGGGCAGGAGGG + Intronic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1059019022 9:110553216-110553238 CACGTCAACTACAGGGAGGAAGG + Intronic
1059419608 9:114182916-114182938 AAGATAAACCAGTGGGTGGAGGG + Intronic
1060197993 9:121635607-121635629 CAGGGCAACCACAGGAAGGAGGG + Intronic
1062095005 9:134698606-134698628 CAGGTACAACACTGGGAGGAAGG - Intronic
1062533593 9:137012101-137012123 CAGGTAATCCAGGGAGAGGCTGG + Exonic
1186098249 X:6127112-6127134 CAGGTAATCCGGAGGGCAGAAGG + Intronic
1188216187 X:27480362-27480384 CATGTAAACCAGAACAAGGAAGG - Intergenic
1188414041 X:29910210-29910232 CAGGTATACTTGAGGGTGGAGGG + Intronic
1188819749 X:34760508-34760530 CATGTAAGACAGAGGGAGAAAGG - Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189852076 X:45187762-45187784 AAAGTAAACGAAAGGGAGGAGGG - Intronic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1193273387 X:79555137-79555159 CATGAAAACAGGAGGGAGGAGGG + Intergenic
1193515527 X:82457379-82457401 CAGAGAAACCAAAGTGAGGAGGG - Intergenic
1195002992 X:100660107-100660129 AATGTAAACTAGAGAGAGGAAGG - Intronic
1195266063 X:103181071-103181093 CAAATAAACCAAAGGAAGGATGG - Intergenic
1195618168 X:106929226-106929248 CAGGTAAACCAGAGGGCAAAGGG - Exonic
1197622544 X:128766593-128766615 CAAGAAAAACAGAGGGAGAAAGG - Intergenic
1199105583 X:143862870-143862892 CAGGAAAAGCAGAGGTAGAAGGG - Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic