ID: 1157825302

View in Genome Browser
Species Human (GRCh38)
Location 18:50806820-50806842
Sequence GAAACTGAGGTTCCAGAAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 6, 3: 35, 4: 343}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157825302_1157825311 17 Left 1157825302 18:50806820-50806842 CCCGCTTCTGGAACCTCAGTTTC 0: 1
1: 0
2: 6
3: 35
4: 343
Right 1157825311 18:50806860-50806882 GGGTCAAAAATGTATTAATTTGG 0: 1
1: 0
2: 1
3: 16
4: 243
1157825302_1157825308 -3 Left 1157825302 18:50806820-50806842 CCCGCTTCTGGAACCTCAGTTTC 0: 1
1: 0
2: 6
3: 35
4: 343
Right 1157825308 18:50806840-50806862 TTCCAAGAGACCTGGGTGATGGG 0: 1
1: 0
2: 1
3: 14
4: 155
1157825302_1157825307 -4 Left 1157825302 18:50806820-50806842 CCCGCTTCTGGAACCTCAGTTTC 0: 1
1: 0
2: 6
3: 35
4: 343
Right 1157825307 18:50806839-50806861 TTTCCAAGAGACCTGGGTGATGG 0: 1
1: 0
2: 0
3: 19
4: 196
1157825302_1157825306 -10 Left 1157825302 18:50806820-50806842 CCCGCTTCTGGAACCTCAGTTTC 0: 1
1: 0
2: 6
3: 35
4: 343
Right 1157825306 18:50806833-50806855 CCTCAGTTTCCAAGAGACCTGGG 0: 1
1: 0
2: 2
3: 41
4: 1319
1157825302_1157825312 18 Left 1157825302 18:50806820-50806842 CCCGCTTCTGGAACCTCAGTTTC 0: 1
1: 0
2: 6
3: 35
4: 343
Right 1157825312 18:50806861-50806883 GGTCAAAAATGTATTAATTTGGG 0: 1
1: 0
2: 3
3: 31
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157825302 Original CRISPR GAAACTGAGGTTCCAGAAGC GGG (reversed) Exonic
901561459 1:10074898-10074920 CAATCTGAGGTTCAAGGAGCAGG - Intronic
901879496 1:12185568-12185590 CAAACTGAGGCTCCAGACGGGGG + Intronic
903137855 1:21321097-21321119 GAAACCGAGGTTCCAAGAGGTGG + Intronic
903956508 1:27029720-27029742 GAAACTGAGGCTCAGGAAGGTGG + Intergenic
905241809 1:36586446-36586468 GAAACCCTGGTTCCAGGAGCTGG - Intergenic
905552446 1:38853994-38854016 TAAACTGAGTTTCTAGAAACTGG + Intronic
905931838 1:41793381-41793403 GAAGCTGAGCTCCAAGAAGCAGG - Intronic
907482922 1:54757160-54757182 GAAACTGAGGCCCCAGCAGGGGG + Exonic
907722988 1:56990791-56990813 GAATCTGAGCTTCTTGAAGCAGG + Intergenic
908926297 1:69258975-69258997 GAAACTTAGGTTGCAGCAACTGG + Intergenic
909351354 1:74656739-74656761 GAAGCTGAGGTTCTAAAAGTAGG + Intronic
909667457 1:78151170-78151192 GACACTGAGTTTTCAAAAGCTGG + Intergenic
910126314 1:83846536-83846558 GAAACTGAGGTTCAGGAAGATGG + Intergenic
910134146 1:83946603-83946625 TAAACTGAAGTTCCAAGAGCTGG - Intronic
910663565 1:89700206-89700228 GAGCCTGTGGTTCCAGAGGCAGG - Intronic
911181338 1:94863190-94863212 GATGCAGAGGTTCCAGAAGCTGG - Intronic
911459871 1:98175774-98175796 GAAAATGAGGTTCAGGAAACAGG - Intergenic
913602156 1:120432075-120432097 TTAACTGAGGTTCCAGAGGAAGG - Intergenic
914084894 1:144444560-144444582 TTAACTGAGGTTCCAGAGGAAGG + Intronic
914190903 1:145409721-145409743 TTAACTGAGGTTCCAGAGGAAGG + Intergenic
914363329 1:146955685-146955707 TTAACTGAGGTTCCAGAGGAAGG - Intronic
914488347 1:148131454-148131476 TTAACTGAGGTTCCAGAGGAAGG + Intronic
914588709 1:149086570-149086592 TTAACTGAGGTTCCAGAGGAAGG + Intronic
915101011 1:153500099-153500121 GAAGATGAGGGTCCAGGAGCTGG + Intergenic
915389434 1:155528080-155528102 GAATCTGAAGTTCCAGAAAGAGG - Intronic
915446196 1:155976307-155976329 AAAACTGTGGTTACAGAAGGGGG - Intronic
915571574 1:156747757-156747779 GAAACTGAGGCTTCATAAGAGGG + Intronic
917586462 1:176432296-176432318 GATACTGTGTTTCCAAAAGCAGG + Intergenic
920550868 1:206859667-206859689 GAAAGTGAGGTTCCAAACCCGGG - Intergenic
921037296 1:211393579-211393601 CAAACCCAGTTTCCAGAAGCAGG + Intergenic
921327102 1:213997186-213997208 GCAACAGAGTTTCCAGCAGCTGG + Exonic
921376427 1:214478767-214478789 GAAACTGAGGCTACATAACCTGG + Intronic
922238724 1:223740994-223741016 GAAACTGAGGTTTAAGGAGGTGG - Intronic
922371232 1:224912150-224912172 GAAAGGGAGGTTCCAGATTCAGG - Intronic
922595447 1:226809545-226809567 GAAACTGAGGGACCAAAAGATGG - Intergenic
922889860 1:229053457-229053479 GAGACTCAGGGTCCAGGAGCGGG - Intergenic
923997917 1:239517416-239517438 GAAAGTGAGGTTTGAGAAGTCGG - Intronic
1063455594 10:6180262-6180284 GAACCTCAGGTTCCAGAGTCAGG + Intronic
1063659581 10:8024972-8024994 GAAAATGAGGTTCCAAAAAGGGG + Intergenic
1064503442 10:16001014-16001036 GAAACTGAGGTTCAGAAAGTAGG - Intergenic
1065117021 10:22493214-22493236 TAAACTGAGGTTCCAGTGCCAGG + Intergenic
1065428380 10:25629164-25629186 GAAACTGAGAGTACAGAAGATGG + Intergenic
1067012348 10:42726490-42726512 TCAACTGAGGTTGCAGAACCAGG + Intergenic
1067311245 10:45115402-45115424 TCAACTGAGGTTGCAGAACCGGG - Intergenic
1068094234 10:52470244-52470266 GAAACTGAGGTTACATAACTAGG - Intergenic
1069472779 10:68707686-68707708 TCAACTGAGATTCCAGAAGGTGG - Intergenic
1070112869 10:73501472-73501494 GAAAATGAGGTGCCAGGAGGAGG - Intronic
1070758483 10:79008464-79008486 GAAACTGAGGTTCCAGACAGGGG - Intergenic
1070787158 10:79168548-79168570 GAAGCTGAGGGTGCACAAGCTGG - Intronic
1070799344 10:79235964-79235986 GAAACTGAGGTTCAAAGAGGAGG - Intronic
1071201887 10:83228603-83228625 GAGAATGAGGTACCAGAGGCAGG + Intergenic
1072015114 10:91338956-91338978 GAAACTGGGTTTGCAGAGGCAGG + Intergenic
1073104933 10:101027177-101027199 GAGACTGGAGTTCTAGAAGCAGG - Intronic
1074320062 10:112393327-112393349 AAAACTGAACTTCCAGAAACTGG - Intronic
1074871848 10:117583161-117583183 GAAAGGGAAGTTCCAGAGGCTGG - Intergenic
1075141924 10:119845540-119845562 GAAACTGTGGTTCCCTAAGGAGG + Intronic
1077753241 11:4997486-4997508 GAGACTAAGGGTCCAGAAGGAGG + Intergenic
1077813877 11:5666504-5666526 GAAAGTGAGGTTGCAGAACCTGG + Intronic
1078145665 11:8720456-8720478 GAAATTGAGTTTCCAGAGACAGG - Intronic
1079016736 11:16875311-16875333 GAAACTGAGGTTCCAGGTTATGG + Intronic
1079328753 11:19516768-19516790 GGACCTGAGTTTCCAGAGGCTGG + Intronic
1079377761 11:19909129-19909151 GAAACTGAGGTCCAAGAAAGGGG - Intronic
1080078110 11:28176387-28176409 GACACTGTGGTTCCAGAGTCAGG - Intronic
1083615323 11:64023347-64023369 GAAACTGAGGCCCCAGGAGGTGG - Intronic
1083921667 11:65784351-65784373 GAAGCTGAGGTTGGAGAGGCAGG - Intergenic
1084030627 11:66478630-66478652 GAAACTGAGGCTCTAACAGCTGG - Intergenic
1085257294 11:75182348-75182370 GAAACTGAGGCCCCAAAAGGGGG - Intronic
1085846662 11:80073653-80073675 GAAACTGAGGCACTAGAAGTTGG - Intergenic
1088921952 11:114266035-114266057 GTAATTTAGGGTCCAGAAGCAGG + Intronic
1089021734 11:115222611-115222633 GAAACTGGGCTTCCTGAAGAGGG + Intronic
1089521582 11:119067920-119067942 GAAGCAGCGGATCCAGAAGCAGG - Exonic
1089568973 11:119389794-119389816 ACACCTGAGGCTCCAGAAGCTGG - Intergenic
1094010782 12:25807330-25807352 GATACTGTGCTTCCAAAAGCTGG + Intergenic
1097426121 12:59446565-59446587 GGAACTCAGGTTCCAGCAGCTGG + Intergenic
1098600122 12:72321228-72321250 GAAACTGAGATAACAGAAGGGGG + Intronic
1098736716 12:74113732-74113754 GAAACTCAGGTTCCAGCCACTGG + Intergenic
1101027389 12:100624492-100624514 GAAACTGAGGACACAGAAACTGG - Exonic
1101807246 12:108075144-108075166 GAAACTGAGGCTCCAAGAGGGGG - Intergenic
1102195664 12:111023546-111023568 GAAACTGAGGTTCATAAAGGTGG + Intergenic
1105324531 13:19358125-19358147 GAAACTGAAGTCACAGGAGCAGG + Intergenic
1105667155 13:22572953-22572975 GAAAGTGAGGTCACAGAAGTAGG - Intergenic
1105790024 13:23789710-23789732 GAAACTGAGGGTCAACAAGAAGG - Intronic
1105868778 13:24485591-24485613 GAAACTGAAGTCACAGGAGCAGG - Intronic
1106125134 13:26895151-26895173 GAAACTGAGGTCAGAGAACCAGG - Intergenic
1106350077 13:28921690-28921712 GAAACTCAGGTTCCACCTGCTGG + Intronic
1107347459 13:39477155-39477177 GAAACAGAGGTTGCAGCAGAGGG - Intronic
1107806753 13:44160602-44160624 CAAAGTCAGGTGCCAGAAGCAGG - Exonic
1108025296 13:46171211-46171233 GAAACTGAGGTTTAAATAGCTGG + Intronic
1109337608 13:61012474-61012496 GAAACTGGGGTTCAAGGATCTGG - Intergenic
1111658962 13:91185673-91185695 GAAACTAAGGTGCCTAAAGCTGG - Intergenic
1113033562 13:106022636-106022658 GAGACTGAAGTTCCTGAAGAGGG - Intergenic
1113082611 13:106534728-106534750 GGAACCGAGGTTCCAGAAACAGG + Intronic
1113790051 13:113023450-113023472 GAAGCAGAAGTTCCGGAAGCTGG + Intronic
1114661671 14:24350091-24350113 GAAACTGAGGTCAGAGAGGCCGG + Intergenic
1114730646 14:24989266-24989288 GTTACTGAGGATACAGAAGCTGG + Intronic
1117328460 14:54689904-54689926 GACACTGAGGCTCCAGCAGAAGG - Intronic
1119189677 14:72672297-72672319 GAAAGTGAGGTTCCTGAAATTGG - Intronic
1119762590 14:77162127-77162149 GAAACTGAGGTTCAATAACTTGG - Intronic
1122087181 14:99316201-99316223 GAAACTGAGGTTCAGGAAGGAGG + Intergenic
1124045759 15:26148496-26148518 GAAACTGAGGTTCCCGGATTTGG - Intergenic
1124229919 15:27935552-27935574 GAAACTGAGGCTCCCGAAGATGG + Intronic
1124335528 15:28853598-28853620 TAAACTGAGGTTGCAGAGCCAGG - Intergenic
1126329236 15:47513996-47514018 GAAACTGAGATTCTAGAGGGTGG + Intronic
1126706473 15:51410555-51410577 GGAAAGGAGGTGCCAGAAGCAGG - Intergenic
1126900935 15:53313691-53313713 GAAACTGGGGCTTCAGAAGTTGG + Intergenic
1127971123 15:63962699-63962721 GAAACAAAGCTTCCAGAAGAGGG - Intronic
1128390352 15:67178540-67178562 AAAACTGAGGTTACAGAAGGAGG + Intronic
1128987991 15:72235188-72235210 GAAACTGGGGTTGCTGAAGGAGG + Intergenic
1129642289 15:77393107-77393129 GGAACTCAGGTTCCAGCTGCTGG - Intronic
1129965255 15:79729258-79729280 GAAGATCAGGTTCCAGAAGGGGG - Intergenic
1131678643 15:94698622-94698644 GAATCTGAGATTCCAGATGCAGG + Intergenic
1131744803 15:95435790-95435812 GAAACAGAGGTTCCAGAACCTGG - Intergenic
1131989930 15:98083272-98083294 GAACTTGAGGCTCCAGAGGCAGG + Intergenic
1132054144 15:98636339-98636361 AAAACTGAAGTTTCAGAAACCGG - Intergenic
1133472541 16:6089462-6089484 GAAACTGAGGTTGTAGAAGCTGG + Intronic
1133634246 16:7651001-7651023 GAAACTCAGGTGCTAGGAGCTGG + Intronic
1133849932 16:9493452-9493474 TAAACTGAGGTTAGAAAAGCTGG - Intergenic
1133881434 16:9786314-9786336 AAAACTAAGGACCCAGAAGCAGG - Intronic
1134106519 16:11489300-11489322 AAAACTAAGGTTCCAAGAGCTGG - Intronic
1135474918 16:22765483-22765505 GAAACTGAGGTCCTGGGAGCTGG + Intergenic
1135543738 16:23351985-23352007 GAAACTGAGGCTCCAGGAGTTGG - Intronic
1135592090 16:23712094-23712116 AAACCTGAGGGTCCTGAAGCAGG - Intronic
1135674686 16:24405271-24405293 GGGACAGAGGTTCCAGGAGCTGG + Intergenic
1136419801 16:30124599-30124621 CTAACTGAGCTTCCAGCAGCAGG - Intergenic
1136746631 16:32596942-32596964 GAAATTGAGGTTCCTGAGGTTGG + Intergenic
1137760187 16:50934269-50934291 GAAACTGAGACACCAGAAGGAGG - Intergenic
1138127728 16:54452640-54452662 GAAAATGAGGATCCTGAATCTGG - Intergenic
1138457966 16:57132181-57132203 GAAACTGAGGTCTCAAAGGCAGG - Intronic
1138513100 16:57520022-57520044 GAAACTGAGGCTCCAGAGAAGGG - Intronic
1140746814 16:77987792-77987814 GCAACTGAGTTTCCAGAATTAGG + Intergenic
1140909082 16:79435577-79435599 GAAACTGAGGCTCAGGAAGCTGG + Intergenic
1141766960 16:86065003-86065025 GAAACTGAGGCTGCAGAGGAGGG - Intergenic
1142194200 16:88732094-88732116 GAAACTGAGGCTCCAGGAGGTGG + Intronic
1203048760 16_KI270728v1_random:856146-856168 GAAATTGAGGTTCCTGAGGTTGG + Intergenic
1142874420 17:2842874-2842896 GAAGCTGAGGCTCCAGAACATGG + Intronic
1143426356 17:6842302-6842324 GCAGCTGAGGTTGCTGAAGCAGG + Intergenic
1146224673 17:31055236-31055258 GAAACTGAGGTTCAGGGATCAGG + Intergenic
1146760903 17:35477183-35477205 GAAACTGAGTTTTCAGTAACTGG + Intronic
1147315297 17:39617542-39617564 GAAGCTGGGGCTCCTGAAGCTGG - Intergenic
1147505478 17:41012516-41012538 GGAAATGAGGTTACAGAAGGTGG + Intronic
1147634398 17:41954462-41954484 ACAGCTGAGGTTCCAGCAGCTGG + Intronic
1150131377 17:62671017-62671039 GAAACTGAGGTTCATGGGGCTGG + Intronic
1151665622 17:75543752-75543774 GAAACTGAGGCTCCATGAGGTGG - Intronic
1151692820 17:75697348-75697370 AAGGCTGAGGTTGCAGAAGCTGG - Intronic
1151924098 17:77181129-77181151 GAAACTGATGTTCTATAAGTAGG + Intronic
1152166247 17:78709214-78709236 GAAACTGAAGTTCAAGGAACCGG + Intronic
1152233849 17:79128360-79128382 CCCACTGAGGTCCCAGAAGCAGG + Intronic
1152243865 17:79175285-79175307 GAAACTGAGGCTCCAGGGACAGG + Intronic
1152423407 17:80205853-80205875 GAAACTGAGATTCAAGGAGTTGG - Intronic
1153537437 18:6117168-6117190 GAGACTGAGGGTCAATAAGCGGG + Intronic
1153962072 18:10148316-10148338 CAAAATGAGATTCCAGAAGTGGG - Intergenic
1156029167 18:32692020-32692042 TAAACTGGGTTTCCATAAGCTGG + Intronic
1157825302 18:50806820-50806842 GAAACTGAGGTTCCAGAAGCGGG - Exonic
1160531585 18:79568113-79568135 GAAACTCAGAGCCCAGAAGCCGG - Intergenic
1160549373 18:79683583-79683605 GAAACTCAGGTGTCAGAAACGGG + Intronic
1160659088 19:290115-290137 AACACTGAGGTTCCAGATGCTGG - Intronic
1161121399 19:2528835-2528857 GAAACAGGGGTTCCAGAGTCTGG + Intronic
1161566464 19:5005524-5005546 GAAACTGAGGCCCCAGAGGTGGG + Intronic
1163831321 19:19548419-19548441 GAAACTGAGGCTCCAAGAGAAGG + Intergenic
1165077277 19:33286867-33286889 GATGCTGAGGCCCCAGAAGCTGG + Intergenic
1165177576 19:33941398-33941420 GAAACTCAGGAGCCTGAAGCAGG + Intergenic
1166592412 19:44011747-44011769 AAAACAGTGGTTCTAGAAGCAGG - Exonic
1167462584 19:49633766-49633788 GAAACAGAGGTTGCAGCAACTGG + Intergenic
1167985284 19:53309432-53309454 GAAACTCAGGTTGCAGGGGCGGG - Intergenic
925877922 2:8328206-8328228 GAGACAGAGGTTCCAGAGGCTGG - Intergenic
925988954 2:9238296-9238318 GAAACTGAGGCTCCAGAAAGAGG - Intronic
926320194 2:11744085-11744107 GAAACTGAGCCTCTAGAATCAGG + Intronic
926468951 2:13228447-13228469 GCAACTGAGGTTACAGAATTTGG - Intergenic
928019994 2:27696801-27696823 CAATCTGAGGTTCCAAGAGCAGG - Intergenic
928021838 2:27711559-27711581 GAAACTGAGGTCCCAGAGAAAGG + Intronic
929901094 2:46004569-46004591 GATGGTGAGCTTCCAGAAGCAGG - Exonic
930878386 2:56245231-56245253 GAAACTCAAGTTCCACCAGCTGG + Intronic
932442923 2:71749243-71749265 GAGACTGGGGTTCTAGAAGGAGG + Intergenic
932658479 2:73630978-73631000 GAAACAGAGGTTACAGTAACTGG + Intergenic
933566641 2:83958267-83958289 GGAACTGAGGTTCCAGACAAAGG - Intergenic
933749048 2:85591458-85591480 GAAGCTGAGGTGCTGGAAGCCGG + Intronic
934045608 2:88170575-88170597 GAACCAAAGGTTCCAGAAACGGG - Intronic
934047605 2:88185621-88185643 GAAACTGTGGGCCCAGAAGAGGG + Intronic
935050380 2:99520267-99520289 GAAAATGATGTTACAGAAGAAGG - Intergenic
937127420 2:119483307-119483329 GAAGCTGAGGTTCCAAGAGGGGG + Intronic
937244471 2:120483685-120483707 GAAGCTGGTGCTCCAGAAGCTGG + Intergenic
937250905 2:120523030-120523052 GAAACTGAGGTCCCAGAGGTTGG - Intergenic
937875199 2:126819844-126819866 GAAACTGAGGGTACAGAGCCTGG - Intergenic
938770822 2:134499367-134499389 GAAACTGCAGTTCTGGAAGCCGG - Intronic
942058590 2:172207315-172207337 GAAAGTGAGGTTCCAGAATGTGG + Intergenic
943498915 2:188661464-188661486 CCAGATGAGGTTCCAGAAGCTGG - Intergenic
943670733 2:190657662-190657684 GACACAGAGGTTCCAGGAGATGG + Intronic
944667853 2:201971849-201971871 GAGACTGAGGTGCCAGGAACAGG + Intergenic
947606503 2:231489472-231489494 GAGGCTGAGGTCCCAGAAGTAGG + Intergenic
1169797219 20:9476171-9476193 GAAGGTGAGGATCCAGAATCAGG - Intronic
1171358575 20:24569339-24569361 GAATCTGAGGTTCCAGCTGCTGG + Intronic
1171379359 20:24722407-24722429 GAGCCTGAGGTTCCACAGGCTGG - Intergenic
1172095933 20:32460524-32460546 GAAACGGAGGCTCCAGAAGGTGG - Intronic
1172508246 20:35479977-35479999 GGAAGTGAGGTGCCTGAAGCTGG + Exonic
1172913237 20:38425635-38425657 CAAACTGTGGTCCCAGAACCAGG - Intergenic
1173164084 20:40674016-40674038 GAAATTCAGGTTGCAGAACCAGG - Intergenic
1173177661 20:40776912-40776934 GAAAATGAGGTTCCAGCAAGTGG + Intergenic
1173469243 20:43309744-43309766 GAAAGTCAGGCTCCAGGAGCTGG - Intergenic
1173904318 20:46614709-46614731 GAAACTGAGGTGCAAGGAGGTGG + Intronic
1174156077 20:48516174-48516196 TAATTTGAGGGTCCAGAAGCTGG - Intergenic
1174420444 20:50395901-50395923 GAAACGGAGCTTCCAGGAGTTGG - Intergenic
1175828659 20:61950649-61950671 GAAACTGAGCTCGAAGAAGCAGG + Intergenic
1177212789 21:18091186-18091208 GAAACTGAAGTTCCAATTGCTGG - Intronic
1178152161 21:29807888-29807910 GAAACTGAGCCTCCAGATGGAGG - Intronic
1178187802 21:30243627-30243649 GAAATTGAGATTCCATAAACAGG + Intergenic
1178717034 21:34974556-34974578 GAAACTGAGGGTTCAGATGAGGG + Intronic
1178859350 21:36276004-36276026 GAAACGGAGATTTGAGAAGCTGG + Intronic
1180205510 21:46256937-46256959 GAAACTGAGGCGCCAAATGCGGG - Exonic
1180384652 22:12169837-12169859 AAAACTGCGCTTCCAGAAGTGGG + Intergenic
1180844116 22:18972245-18972267 GAAACTGAGGTACTGGAGGCGGG - Intergenic
1181856353 22:25784082-25784104 GAAACTGAGGAGCAAGAATCAGG - Intronic
1181972695 22:26704458-26704480 AAAACTTAGGTTACAGAACCAGG - Intergenic
1182810385 22:33111229-33111251 GAAACCAAGGTTCCAGAAATGGG - Intergenic
1183204654 22:36410336-36410358 AGAACTGAAATTCCAGAAGCCGG + Intergenic
1183926453 22:41209834-41209856 GAAAATGAGGATCGGGAAGCAGG + Exonic
1185394336 22:50579053-50579075 GAAACTGAGGTTCAGGAGACCGG - Exonic
949507327 3:4739960-4739982 GAAACAGTGTTTCAAGAAGCAGG + Intronic
949530126 3:4947405-4947427 GAAACAGAGGCCCCAGGAGCCGG - Intergenic
950357413 3:12423553-12423575 GAAGCAGAGGCTCCATAAGCCGG - Intronic
950525484 3:13520511-13520533 GAAACTGAGGGTCGGGAAGGAGG - Intergenic
951303746 3:21030814-21030836 GAACCTGAGGTGCCATAAGTGGG - Intergenic
951314259 3:21169157-21169179 AAAGCTGAGGCTCCAGTAGCTGG - Intergenic
951402066 3:22245117-22245139 GAAACTGAGGTTCCAAAGTTTGG + Intronic
951599643 3:24359362-24359384 GTGACTGAGGCTCCAAAAGCAGG + Intronic
952752559 3:36837104-36837126 GATCCTGAGGATCCAGAAGAAGG - Intronic
954130726 3:48559369-48559391 GAAACTGAGGGTCAGGAAGAGGG + Intronic
955059519 3:55483539-55483561 GAAACTGAGTTTCCCAAAGAAGG + Intronic
956732662 3:72210999-72211021 GAAGCTGAGGTTCCTGCACCCGG - Intergenic
957225552 3:77440825-77440847 GAGACTGAGCTTCCACAACCAGG - Intronic
957538079 3:81531876-81531898 GGAACTCAGGTTCCAAATGCTGG + Intronic
958045806 3:88282362-88282384 GAAAATGAGCTTCAAGAATCTGG + Intergenic
958893808 3:99808391-99808413 GAAACAGCAGTTCAAGAAGCAGG + Intergenic
958983640 3:100754811-100754833 GTAACATATGTTCCAGAAGCAGG + Intronic
960957920 3:123047469-123047491 GAAACTGAGGTTCAGAAAGGAGG + Intergenic
962271966 3:133983986-133984008 GAAACGGGGGATCCAGAAGGAGG + Intronic
964020709 3:152006962-152006984 GGAACTGATGTTCCAGGAGGAGG + Intergenic
964284377 3:155101568-155101590 GAAACTCATTTTCCAGAAGTGGG - Intronic
965009105 3:163063091-163063113 GACACTGGGGTTCCAGATGGAGG + Intergenic
965087143 3:164113753-164113775 GAAACTGAGGCTACAGACTCAGG + Intergenic
967317321 3:188161575-188161597 GAAACTGAGGCCCCAGAAAAGGG + Intronic
967705889 3:192650257-192650279 GAAACTGAGGTTGAAAAAGGAGG - Intronic
968940307 4:3634213-3634235 GGAGCTGAGGTTGCAGAATCGGG + Intergenic
969085078 4:4650513-4650535 GAAACTGAGATTCAGAAAGCAGG + Intergenic
970374493 4:15442835-15442857 GAATCTGGGGTTCCAGAAGGTGG + Exonic
971215107 4:24655410-24655432 GGAACTGTGGTTCCTGAAGCTGG - Intergenic
971227654 4:24769774-24769796 GTTCCTGAGGTTCCAGAAGAGGG + Intergenic
978921518 4:114189114-114189136 GAAACAGAGGTTCAGGAAGGTGG - Intergenic
981115795 4:140989607-140989629 GAAACTAAGCTTCCAGAAAGAGG + Intronic
982679363 4:158410428-158410450 GAAAATGAAGATCCAGAAGAGGG + Intronic
983477239 4:168229245-168229267 GAAACTGAAGTTCCAGATCATGG + Intronic
983781403 4:171674501-171674523 GAACCCCAGGCTCCAGAAGCAGG + Intergenic
984501184 4:180561016-180561038 TAAAATGAGGCTCCAGTAGCAGG + Intergenic
985521237 5:374776-374798 GAATCTGAGGTACCAGCTGCAGG - Intronic
986393934 5:7309711-7309733 TAAACTGAGGTTGCAGAGCCAGG - Intergenic
987060645 5:14240069-14240091 GAAACTGAGGTTGCAAAGGAAGG - Intronic
987630961 5:20471211-20471233 GAAACTGAGTTTACAGAAAGTGG - Intronic
987719127 5:21612315-21612337 CTTACTGAGGTTCCAGAAGAAGG - Intergenic
988504315 5:31808565-31808587 GAAACTGAGGCTTCAGGAGGTGG + Intronic
988818527 5:34858122-34858144 GAATCTTGGGCTCCAGAAGCAGG + Intronic
989626835 5:43437799-43437821 GAAAATGAAGTTAAAGAAGCAGG + Intergenic
990205983 5:53430180-53430202 GAAAATGAGGGGCCAGAGGCAGG - Intergenic
990553593 5:56909130-56909152 GAAACTCGGGTTCCCGAAGTCGG + Intergenic
990579147 5:57151360-57151382 AAAACTCAGGTTCCAGCTGCTGG + Intergenic
991188318 5:63837714-63837736 GAAATTGTGTTTCCAAAAGCAGG + Intergenic
991319478 5:65354321-65354343 AAAACTGAAGTTCCATAAGTAGG - Intronic
992433502 5:76732612-76732634 GAAAATGAAGGTCAAGAAGCCGG + Exonic
995591210 5:113701612-113701634 GAAGATGAGGTCCCAGAAGTAGG - Intergenic
996320819 5:122213427-122213449 GAAAATGAGTTTCCAGAAGGTGG - Intergenic
996741087 5:126799584-126799606 GGTACTGAGGGTCCAGAAGAAGG + Intronic
996992074 5:129647455-129647477 GAATCTGAGGTTGCACAACCAGG - Intronic
998854941 5:146385690-146385712 AAAACTGAGGTGCCGGAAGAGGG - Intergenic
999650424 5:153761989-153762011 AAAACAGTGGTTCCAGAGGCTGG + Intronic
999767707 5:154754393-154754415 GAAACTGAGGCCCACGAAGCTGG + Intronic
999811481 5:155131509-155131531 GAACCCCAGGCTCCAGAAGCAGG - Intergenic
1000010378 5:157225686-157225708 GAAAGGGAGGTTCCAGACGAGGG - Intronic
1000378511 5:160606941-160606963 GAAGCTGTGGTTCCAGAAGCTGG - Exonic
1000806874 5:165806126-165806148 GAAACGGAAGTTCCAGCTGCAGG + Intergenic
1001460331 5:171906693-171906715 GAAACTGAGGCTCCAGAAAGTGG + Intronic
1001514620 5:172346627-172346649 AAAACTGAGGCTCCAGAAGGGGG - Intronic
1001810154 5:174621494-174621516 GAAACTGAGGCTCAAAGAGCTGG + Intergenic
1002421673 5:179152325-179152347 GCATCTCAGGTTCCAGAACCCGG - Intronic
1003952469 6:11128689-11128711 GGAACTCAGGTTCCAGTTGCTGG + Intronic
1004282348 6:14291732-14291754 GAAACTGAGGTTCCTGAGGATGG + Intergenic
1005025327 6:21457794-21457816 GAACCTGAGATTCCAACAGCTGG - Intergenic
1005276465 6:24224581-24224603 AAAACTGGGGTGGCAGAAGCCGG + Intronic
1005278519 6:24245261-24245283 GAAACTTAGGTTCGAGCGGCTGG + Intronic
1005739255 6:28775303-28775325 CAAACTGGGGATCCAGAGGCAGG + Intergenic
1005890742 6:30135850-30135872 GATCCTGGGGTTCCATAAGCTGG + Intergenic
1005897998 6:30194782-30194804 GAGACAGAGGTTGCAGAGGCAGG + Intronic
1006806718 6:36793778-36793800 GGAATTGAGGTTGCAGCAGCTGG - Intronic
1007165647 6:39827245-39827267 GAAACTGAGGCCCAAGAAGCAGG - Intronic
1007729015 6:43934589-43934611 GAAAGTGAGGATCCTGGAGCTGG - Intergenic
1008001237 6:46362185-46362207 GTCACTTAGGTTCCAGAAGTGGG - Intronic
1009850344 6:69189137-69189159 GAAACTGAAGTTCCACAATCTGG + Intronic
1010033892 6:71299231-71299253 GAAGCTGAGGTTCCAGACAGAGG - Intronic
1011291252 6:85779574-85779596 GAAACTCAGGTTCCAGCAGCTGG + Intergenic
1013089157 6:106883675-106883697 GAAAGTGAGGAGCCAGAAACAGG + Intergenic
1014011976 6:116486593-116486615 GTAACTGAAATTCCAGAGGCAGG + Intergenic
1014310383 6:119792383-119792405 AAAATTGGGGTTCCAGAACCAGG - Intergenic
1015465391 6:133543165-133543187 GAAGCTGAGGCTCCAGAAGAAGG + Intergenic
1016651236 6:146463349-146463371 GAAACTGAGGCTTGAAAAGCTGG - Intergenic
1017924825 6:158901681-158901703 GAAACTCAGGTTCCAGCCGTTGG + Intronic
1019722658 7:2582594-2582616 GAAGCAGAGGATCCTGAAGCTGG + Exonic
1019781766 7:2944583-2944605 AAAAAGGAGGTTCCAGACGCAGG + Intronic
1021472776 7:21024632-21024654 GGAACTGAGGCTCCAGAAGCAGG - Intergenic
1021872062 7:25016699-25016721 CAAACTGAAGTTCCAGCAGACGG - Intergenic
1022602446 7:31774049-31774071 GAAATTGAAGTTACAAAAGCAGG + Intronic
1023089409 7:36603677-36603699 GAAACTTAGTTTACAAAAGCAGG + Intronic
1023110405 7:36805435-36805457 GAAAGAGAAGTTTCAGAAGCAGG - Intergenic
1023404142 7:39813694-39813716 GAAACTAATGTTCTAGAACCTGG - Intergenic
1024369201 7:48560178-48560200 GAAACTCAGGTTCCAACTGCTGG + Intronic
1026615615 7:71900652-71900674 GTAACAGATGTTCCAGAAGGGGG + Intronic
1028579896 7:92397716-92397738 GAAACAGATATTCCAGAAGGCGG + Exonic
1029746127 7:102516708-102516730 GAAACTGAGGCTCTAGGAGCAGG + Intronic
1029764065 7:102615687-102615709 GAAACTGAGGCTCTAGGAGCAGG + Intronic
1030662643 7:112238390-112238412 GGAACTCAGGTTCCAAAGGCTGG - Intronic
1031098388 7:117448336-117448358 GAAACTAACATTCCAAAAGCTGG - Intergenic
1032316081 7:130840384-130840406 CAAAGTGAACTTCCAGAAGCAGG - Intergenic
1032800143 7:135311097-135311119 GAAACTGACATTCCAGCAGAAGG - Intergenic
1033427468 7:141257145-141257167 GAGATTGATGTTGCAGAAGCAGG + Intronic
1033525249 7:142207137-142207159 GAAACTGATTTTTCAGAAACAGG + Intronic
1033636126 7:143212725-143212747 GACACTGAGACTCCAAAAGCAGG - Intergenic
1033770288 7:144543634-144543656 AAAACTGAGGTTCCATCAGTAGG - Intronic
1034517238 7:151590490-151590512 GAAGCTGAGATTCCAGATTCGGG + Intronic
1035693493 8:1575369-1575391 GGAATGGAGGTTACAGAAGCTGG + Intronic
1035934553 8:3821889-3821911 TGAACTGTGCTTCCAGAAGCTGG + Intronic
1037614816 8:20509275-20509297 GAAACTGAGGTTCGAAAAGATGG + Intergenic
1037784963 8:21897172-21897194 GAAACTGAGCTCGCAGAAACTGG - Intergenic
1038766093 8:30429169-30429191 GAAACTGAGGTCCCAAAATGTGG + Intronic
1038911684 8:31971969-31971991 GAAACCCAGGTTCCAAATGCAGG - Intronic
1041190548 8:55349477-55349499 GAATCAGAGGATGCAGAAGCTGG - Intronic
1041725936 8:61017396-61017418 GACACGGAGGTGCAAGAAGCCGG + Intergenic
1045702214 8:104880193-104880215 GAAACTGAGGCTCAAAAAGATGG - Intronic
1046152570 8:110246949-110246971 GAAAGCAAGGTTCCAGAAGTGGG - Intergenic
1046591573 8:116213570-116213592 GAAACTAAGGAACCAGAAACTGG - Intergenic
1047127307 8:121976463-121976485 GGAACTGAGGTTACAGAGGAGGG + Intergenic
1047133341 8:122047788-122047810 CAAGCTGAGGTTCCATAAGAGGG - Intergenic
1049264613 8:141660779-141660801 GGAACTGGGGCCCCAGAAGCAGG - Intergenic
1049410421 8:142471543-142471565 GAAACTGAGGCTCCCTGAGCTGG - Intronic
1050738603 9:8793007-8793029 GAAACTCAAGCTCAAGAAGCTGG + Intronic
1050838751 9:10119136-10119158 GAAACTAAAGTTCCATAAGAAGG + Intronic
1051358795 9:16263948-16263970 GAAACTGAGGCTCCCGACTCTGG - Intronic
1051527632 9:18064500-18064522 GAAACTGTGGTTCAAGAAGGAGG - Intergenic
1051694183 9:19750760-19750782 GAAAGTGATGGTCGAGAAGCTGG - Intronic
1052206029 9:25841462-25841484 AAGACTGAGATACCAGAAGCTGG - Intergenic
1052745261 9:32434171-32434193 GAAACTGATGATCTAGAAGTTGG + Intronic
1055486911 9:76765242-76765264 GAAACAGAGCTTCCAGCAGGTGG + Intronic
1056070829 9:82985002-82985024 GAAAAGGAGATTCCAGATGCAGG + Intronic
1056814274 9:89790224-89790246 GGCCATGAGGTTCCAGAAGCAGG - Intergenic
1058001043 9:99865217-99865239 GTAACTCAGCTTCCAGGAGCTGG - Exonic
1058670899 9:107359683-107359705 GAACTCAAGGTTCCAGAAGCAGG + Intergenic
1058985309 9:110204309-110204331 GTAACTGCATTTCCAGAAGCTGG + Intronic
1059727823 9:117026670-117026692 GAATCTGAGGTTGCCTAAGCTGG - Intronic
1060538687 9:124414473-124414495 GAAAGTGAGCTGCCAGAAGTTGG + Intronic
1060569982 9:124629509-124629531 GAAACTGAGGCTCCAGAAGATGG + Intronic
1061205378 9:129160052-129160074 GAAGCAGAGGTTCCAGAGGAAGG - Intergenic
1061236051 9:129343241-129343263 GAACCTGAGTTTCCAAAATCAGG + Intergenic
1061284487 9:129614254-129614276 GAAACCAAGGCCCCAGAAGCAGG - Intronic
1061290647 9:129648863-129648885 GAAACTGAGGTAGCAGGGGCTGG + Intergenic
1061748515 9:132757625-132757647 GAAACTGAGGCTCCGAAAGGCGG + Intronic
1061924343 9:133798567-133798589 GACCCTGAGGCTCCAGAGGCCGG - Intronic
1061932452 9:133840233-133840255 GAAACTCTGCTTCCCGAAGCCGG - Intronic
1185643438 X:1600694-1600716 GAAGCTGAGGCTCCAGCAGCAGG + Exonic
1186932741 X:14412704-14412726 GAAACTGAAGTTCCAACTGCTGG - Intergenic
1188404969 X:29796796-29796818 GAAACTGAGATTGGAGATGCAGG - Intronic
1190832598 X:54072856-54072878 GAATCTGAAGTCCCAGAAACAGG + Exonic
1191812488 X:65203895-65203917 TGAACTGAGGTTCCAAATGCTGG + Intergenic
1191820360 X:65299887-65299909 GAACCTGAGGTTCCAGATTATGG + Intergenic
1192202347 X:69074499-69074521 GAAACTGAGGTCCAAGAAGGAGG + Intergenic
1193418465 X:81253939-81253961 GAAATTGAGGATCAGGAAGCAGG + Intronic
1193744243 X:85255687-85255709 GAAACTGTGATTCAAGCAGCTGG + Exonic
1194440248 X:93923997-93924019 GATACTGATGATCCAGACGCTGG - Intergenic
1194842061 X:98754676-98754698 GAAACTCAAGTTCCAAACGCTGG + Intergenic
1194855967 X:98929152-98929174 CAAACTGAGGTTCAACAAGAAGG - Intergenic
1196080775 X:111628112-111628134 GGGACTGTGGATCCAGAAGCAGG - Intergenic
1197015915 X:121626314-121626336 GGAACTCAGGTTCCAATAGCTGG - Intergenic
1197105874 X:122715041-122715063 GAAATTTTGGTTCCAGAAACAGG - Intergenic
1197366735 X:125572834-125572856 GAATCTAACATTCCAGAAGCTGG + Intergenic
1197402198 X:126006048-126006070 GAGACTGAGCTTCCAGAGGGAGG + Intergenic
1197739215 X:129876425-129876447 AAACCCGAGGCTCCAGAAGCAGG + Intergenic
1199290872 X:146103858-146103880 GATCCTGAGGTCCGAGAAGCTGG + Intergenic
1199540495 X:148953058-148953080 GAAACTGAGGTTCAGAAAGGGGG - Intronic
1200141019 X:153903029-153903051 GAAGCTGAGGTGCCAAGAGCTGG + Intronic
1201939677 Y:19446430-19446452 TTTACTGAGGTTCCAGAAGAAGG + Intergenic
1202198120 Y:22317237-22317259 GAAACTCAGGTGGCTGAAGCAGG - Intronic