ID: 1157825307

View in Genome Browser
Species Human (GRCh38)
Location 18:50806839-50806861
Sequence TTTCCAAGAGACCTGGGTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157825302_1157825307 -4 Left 1157825302 18:50806820-50806842 CCCGCTTCTGGAACCTCAGTTTC 0: 1
1: 0
2: 6
3: 35
4: 343
Right 1157825307 18:50806839-50806861 TTTCCAAGAGACCTGGGTGATGG 0: 1
1: 0
2: 0
3: 19
4: 196
1157825303_1157825307 -5 Left 1157825303 18:50806821-50806843 CCGCTTCTGGAACCTCAGTTTCC 0: 1
1: 1
2: 14
3: 83
4: 478
Right 1157825307 18:50806839-50806861 TTTCCAAGAGACCTGGGTGATGG 0: 1
1: 0
2: 0
3: 19
4: 196
1157825299_1157825307 26 Left 1157825299 18:50806790-50806812 CCAAGATGAAAAACACATTCTTC 0: 1
1: 0
2: 3
3: 47
4: 545
Right 1157825307 18:50806839-50806861 TTTCCAAGAGACCTGGGTGATGG 0: 1
1: 0
2: 0
3: 19
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157825307 Original CRISPR TTTCCAAGAGACCTGGGTGA TGG Exonic
900094205 1:933789-933811 CTTCCAGGAGACCTAGATGACGG - Intronic
902369796 1:15998748-15998770 TTTCCCAGGGTCCTGGGAGAGGG + Intergenic
904331269 1:29759045-29759067 TTTCCCAGAGACCTGAGTGGAGG + Intergenic
904415416 1:30358536-30358558 TTTCCCAAAGACCTGGGTGGAGG - Intergenic
907999976 1:59670234-59670256 TTTCTCTGAGTCCTGGGTGAAGG - Intronic
911187140 1:94915589-94915611 TCTCCAAGAGACCTTTGTGTTGG - Intronic
912510396 1:110185758-110185780 TTTCCAGGATTCCTGGGTGATGG - Intronic
914914063 1:151807460-151807482 TGTCCAAGTGACCTGGAAGAGGG - Exonic
916217576 1:162410605-162410627 TATCAAAGAGACCTAGCTGAAGG - Intronic
919775762 1:201193038-201193060 TTTCCCAGAGACCAGGGAGTGGG - Intronic
919973034 1:202593046-202593068 TTTCTCAGAGCCCTGGGTGGTGG - Exonic
920344706 1:205298780-205298802 TTCCAAAGAGACCTAGATGAGGG - Intergenic
923821967 1:237454830-237454852 CTTGCAAAAGACCAGGGTGAGGG - Intronic
1064907455 10:20362112-20362134 TTTCCAAGAGTACTGGCTGTTGG + Intergenic
1067203878 10:44197509-44197531 TTTTGAGGAGACCTCGGTGACGG + Intergenic
1068123241 10:52806292-52806314 TTTTCCAGGGACTTGGGTGATGG + Intergenic
1068175870 10:53457487-53457509 TTTCTAATAGACCTGGCTGGAGG - Intergenic
1069612486 10:69783879-69783901 TATCCAAGAGACCAAGGTGGAGG - Intergenic
1070693730 10:78546439-78546461 TTTCCCAGGGACCAGGGTAAAGG + Intergenic
1072407597 10:95169303-95169325 TTCCCAAGATACAAGGGTGATGG - Intergenic
1072424679 10:95320145-95320167 TTGGCAAGAGAGCTGGGGGAAGG - Intronic
1072960548 10:99925294-99925316 TTTCCAAGGTAACTGGGTCAAGG - Intronic
1075539724 10:123301961-123301983 AGTCCAATAGACTTGGGTGAAGG + Intergenic
1076343889 10:129767459-129767481 TTTCAGTGAGACCTGGGTGTGGG - Exonic
1077932581 11:6750179-6750201 TTTCCAAGATGGCTGGGTGGAGG - Intergenic
1078095257 11:8292581-8292603 CTGCCAAGAGACCTGGGTCCTGG + Intergenic
1078559962 11:12362962-12362984 TTTCTAAGTGAACTGGGAGAGGG - Intergenic
1080261886 11:30358373-30358395 ATTCCAAGAGACCAGAGAGAGGG - Intergenic
1080859335 11:36139758-36139780 TCTCCAGGAGACGAGGGTGAAGG + Intronic
1081860476 11:46330855-46330877 TTTCCAAGCGGCCTGGGCCAGGG - Intergenic
1082704138 11:56472544-56472566 ATACCAAGAGCCCTGAGTGACGG + Intergenic
1083656572 11:64232641-64232663 TACCCAAGAGACCTGGGGGTGGG - Intronic
1084416901 11:69037728-69037750 GTTCCAAAAGACATGCGTGACGG + Intergenic
1084953968 11:72681552-72681574 TTTCCTAGAGAGCTGTGTGTGGG + Intergenic
1086223187 11:84474981-84475003 ATAACAAGAGACCTGGCTGATGG - Intronic
1088226687 11:107628136-107628158 TTTCCAAGAGAGCAAGCTGAGGG + Intronic
1089442375 11:118528392-118528414 GTTCCAAGAGACCTGGGAAGGGG - Intronic
1091208507 11:133836470-133836492 TCTCCAGCAGAGCTGGGTGAAGG - Intergenic
1094541749 12:31368713-31368735 TTTCCAAGAGAAGAGGGTGATGG - Intergenic
1095892751 12:47249961-47249983 TTTGCATGAGAGCTGGGTGAGGG + Intergenic
1096911545 12:54989467-54989489 TTTCCATGGGAGCAGGGTGAGGG + Intergenic
1097186425 12:57198848-57198870 TTCCCAAGGGAGCTGGGTGGTGG - Intronic
1100060096 12:90565158-90565180 TTTCCAAGAGAACTAGGAGATGG - Intergenic
1100348847 12:93759359-93759381 CTTTCAAGAAAGCTGGGTGAAGG - Intronic
1101635293 12:106535569-106535591 TTTGCATGGGAGCTGGGTGAGGG - Intronic
1101917876 12:108910314-108910336 TTTCCCAGAGACTAGGGTAAAGG - Intergenic
1102019592 12:109672846-109672868 TTTCCTGGAGGCCAGGGTGACGG + Intergenic
1102571262 12:113828486-113828508 ATTCCAAGAGGCCGGGGTGAAGG + Intronic
1102597083 12:114001130-114001152 TCTCCAAGACAGCTGGGTGCTGG - Intergenic
1103172273 12:118831978-118832000 TTCCCAAGAGAACTGAGAGAAGG - Intergenic
1110511154 13:76352606-76352628 TTCCCAAGAGACATGGGGAAGGG - Intergenic
1110658586 13:78030718-78030740 TTCTCAAGAGATCTGGGAGAAGG - Intergenic
1112525697 13:100144852-100144874 TTTGCAAGAGAGATGGCTGATGG + Intronic
1114065711 14:19058421-19058443 TTTCCAAGGAACCTTAGTGATGG - Intergenic
1114096550 14:19341579-19341601 TTTCCAAGGAACCTTAGTGATGG + Intergenic
1114648111 14:24266923-24266945 TTCCCAGGAGACCTGGGAGAGGG + Intronic
1114931508 14:27474557-27474579 TGTCCAAGAGACCTAGGACAGGG - Intergenic
1115263778 14:31479690-31479712 TTTTCATGAGACCTAGGTCAGGG - Intergenic
1115521097 14:34233712-34233734 TTTCCTAGTGACCTGTGTGCTGG - Intronic
1116061773 14:39932937-39932959 TTTCCAAGAGAAGCGTGTGATGG + Intergenic
1119645754 14:76347079-76347101 TTTCCAAGAGGCCAGGGTAAGGG - Intronic
1122504818 14:102225849-102225871 TTTCCAGGGCACCTGAGTGAGGG - Intronic
1122838861 14:104444824-104444846 TTTCCAAGGCAGCTGGGTGCGGG + Intergenic
1122938317 14:104970104-104970126 TTTCCAAGGAGCCTGGGTGTGGG - Intronic
1126662758 15:51048568-51048590 TTTCAAAGAGAGCTTGGTAAGGG + Intergenic
1129047758 15:72751962-72751984 TTTCCTAGAGACCAGGATGTTGG + Exonic
1130869864 15:87962003-87962025 ATTCCAAGATCCCTGGGTGCTGG - Intronic
1131377412 15:91937077-91937099 TCTCCATGAGAAGTGGGTGAAGG + Intronic
1131754502 15:95545244-95545266 TTACCAAGACCCCGGGGTGAGGG + Intergenic
1131786488 15:95917976-95917998 TATCCATGAGGCCTGGGGGAGGG - Intergenic
1132403637 15:101529099-101529121 GTTCCATGAGGCCTGGGTGGAGG - Intergenic
1132727235 16:1344216-1344238 TTGCCCAGACACCTGGGTGGGGG - Exonic
1133323935 16:4931917-4931939 CTTCCAAGAGAACTGGGCAAGGG + Intronic
1134814740 16:17196622-17196644 TTCCCAGGAGACCTAGATGAAGG - Intronic
1135305466 16:21364166-21364188 TGTCCAGGGGACCTGGGTAAAGG - Intergenic
1135499471 16:22981300-22981322 TTCCCAGGAGACCAGGGAGAAGG + Intergenic
1136302204 16:29343318-29343340 TGTCCAGGGGACCTGGGTAAAGG - Intergenic
1138224212 16:55278697-55278719 TGTCCAAGAAACCAGAGTGAGGG + Intergenic
1143590127 17:7880428-7880450 TTTCAAAGAGACCTGGTTAGAGG + Intronic
1143780342 17:9225813-9225835 CATCCAAGTGCCCTGGGTGAAGG - Intronic
1145194494 17:20877657-20877679 TTTTCAAGTGACATAGGTGATGG + Intronic
1145297543 17:21603399-21603421 TTTTCAAGTGACATAGGTGATGG - Intergenic
1145352711 17:22100005-22100027 TTTTCAAGTGACATAGGTGATGG + Intergenic
1147175845 17:38655730-38655752 TTCCCGAGGGACCTGGGGGATGG + Intergenic
1147537953 17:41333129-41333151 TTTCCCAGGGGCCTGGGAGAGGG + Intergenic
1155695864 18:28685821-28685843 TTTCCAAGAGAACTGACTAATGG + Intergenic
1156931930 18:42655452-42655474 TTTCCAAGAATCTTGGATGAAGG + Intergenic
1157825307 18:50806839-50806861 TTTCCAAGAGACCTGGGTGATGG + Exonic
1159779619 18:72645961-72645983 TTTACAGTAGTCCTGGGTGACGG - Intergenic
1159817851 18:73099255-73099277 TTTCCATGGGACCTGGGAGGAGG - Intergenic
1162038956 19:7957886-7957908 TTTCCGAGAGACCGGGCTGCGGG + Intergenic
1163190121 19:15671208-15671230 TGTTGAAGAGACCTGAGTGATGG - Intergenic
1164969133 19:32515814-32515836 CTTCCAAGAGATCTGGAGGAAGG + Intergenic
1167049832 19:47071674-47071696 TTTCAAAGAGACTTGGACGAAGG + Intronic
1167618843 19:50550358-50550380 TTCCCAAGAGACCAGGAGGAGGG + Intronic
925546025 2:5017677-5017699 ATTCCATGGGACCTGTGTGAAGG + Intergenic
925662058 2:6213145-6213167 TGTGCAGGAGACCTGGCTGAGGG + Intergenic
927073266 2:19551113-19551135 TGTCCCAGGGACCTGAGTGAGGG + Intergenic
932433893 2:71691872-71691894 TTGGAAAGAGAACTGGGTGAGGG + Intergenic
932874172 2:75433216-75433238 CTTCCAAGAGACTTGGAGGAAGG + Intergenic
932978043 2:76628466-76628488 TTTCCAATAGACCTGACTTAAGG - Intergenic
933406977 2:81872904-81872926 TTTCCATGAGAAATGGATGAGGG + Intergenic
933778141 2:85784138-85784160 TTTCACAGAGACCAGGGGGAAGG - Intronic
937120285 2:119436146-119436168 TTGCCAGGAGACCGGGGTGGGGG + Intronic
938483127 2:131678790-131678812 TTTCCAAGGAACCTTAGTGATGG - Intergenic
938730738 2:134145075-134145097 TTTCCAAAAGACCAAGGTGGGGG - Intronic
944526490 2:200624984-200625006 TCTCCAGGAGAACTGGGTGTTGG + Intronic
947111335 2:226722242-226722264 TTTCAAAGACACCGTGGTGAGGG + Intergenic
947232619 2:227903255-227903277 ATTCCAAAAGACTTGGGTGGAGG + Intronic
948810170 2:240470978-240471000 GTACCCACAGACCTGGGTGAGGG + Intergenic
1171563029 20:26145338-26145360 TTTTCAAGTGACATAGGTGATGG + Intergenic
1172035588 20:32008521-32008543 TTGCCAAGACACCTGGGTTCTGG - Intergenic
1173810595 20:45952866-45952888 TTTACAAGAGACATGGTAGAGGG - Intronic
1174615207 20:51830106-51830128 TCTCCAAGGGTCCTGTGTGAGGG - Intergenic
1175445384 20:59016124-59016146 GTTCCAAGAAACCTGGATGTTGG - Intergenic
1175996910 20:62816144-62816166 TTTTCAAGATTCCTGGGGGAGGG + Intergenic
1176017502 20:62943132-62943154 TGTCCAAGAGCTCTGGGTGGAGG - Exonic
1178731469 21:35106824-35106846 TTTCCAAAAGCCTTGGCTGATGG - Intronic
1179104447 21:38386041-38386063 TTTATAAGAGAAATGGGTGAGGG - Intronic
1180484192 22:15781013-15781035 TTTCCAAGGAACCTTAGTGATGG - Intergenic
1181633087 22:24161633-24161655 TGACCAAGAGGCCTGGCTGAGGG - Intronic
1181693124 22:24577114-24577136 CCTCCCAGAGACCTGGATGAAGG - Intronic
1184471987 22:44701589-44701611 CATCCAAGAGACCTGGGGGTGGG + Intronic
949489760 3:4577343-4577365 TTAACAAGAGCCCTGGGTGATGG - Intronic
949899398 3:8797352-8797374 TTTCCAAGTCACTTGGTTGATGG - Intronic
950546579 3:13641605-13641627 TTTCTAAGAGAACTGGGGAAGGG - Intergenic
950604349 3:14064954-14064976 TTCCCAAGAGGCCAGGCTGATGG - Exonic
951104387 3:18726049-18726071 TCTACAAGAGACTTGGGTGAAGG - Intergenic
951854031 3:27174818-27174840 TTTCCAGGAGACCTTTGAGAAGG - Intronic
953182532 3:40609473-40609495 TTTCCAAGACAGCTCTGTGAAGG + Intergenic
956198124 3:66674042-66674064 TTTTCCACAGACCGGGGTGAGGG - Intergenic
958777822 3:98506782-98506804 GTTCCAAGAGAACTGGTTTAAGG + Intronic
958917177 3:100062565-100062587 TTTCCAAGAGATTTGTGTGTTGG + Intronic
959234834 3:103707133-103707155 TTTCCCACAGACCTTGTTGAAGG + Intergenic
959398652 3:105871981-105872003 TTTCTGGGAGACCTGGGGGAAGG - Intergenic
962880718 3:139573899-139573921 TTTCCATGTGACATGGGTGAAGG + Intronic
965046945 3:163590588-163590610 TTTCCAAGGGCCCAGGGAGAAGG + Intergenic
965363867 3:167774774-167774796 TTTTCAATAGACAGGGGTGAGGG - Intronic
965366783 3:167810642-167810664 TTTCTAATAGACCAGGGTGGTGG + Intronic
965462873 3:168990328-168990350 TCTTCAAGAGAGCTGGGTCAGGG + Intergenic
965909672 3:173757417-173757439 TTTACAAGAAACATAGGTGATGG + Intronic
966686657 3:182703275-182703297 TTTGCAGGGGAGCTGGGTGAGGG - Intergenic
973011774 4:45084336-45084358 TTTCCAAGAGACAATGGTAATGG + Intergenic
975467853 4:74730152-74730174 GTACAAAGAGACCTGGGTCATGG + Intergenic
976346790 4:84012936-84012958 TGTCCAAGAGACCTGAGCAAAGG + Intergenic
978301210 4:107270784-107270806 GTCCCATGAGACCTGGCTGAAGG - Intronic
978555936 4:109980378-109980400 TTTCGAAGAGCCTTGGGTTAAGG + Intronic
979231284 4:118352134-118352156 TTTCCAAGAGACCTGTACGCCGG + Intronic
981637285 4:146895251-146895273 CTTCCAAGAAACTTGAGTGAAGG + Intronic
983625632 4:169799001-169799023 TTTCTAAGAGTCCTAGGAGATGG - Intergenic
983762234 4:171425225-171425247 TTTCAAAGAAATATGGGTGAGGG - Intergenic
984305768 4:177988492-177988514 TTGCCAAGAGACCAAGGGGAGGG + Intronic
985121270 4:186644917-186644939 TTTGCAAGAAACCAGGATGAAGG + Intronic
985122087 4:186654239-186654261 TTTACAAGAGCCCTGTGAGATGG - Intronic
985315744 4:188657298-188657320 TTCACAAGAGACATGGGGGAAGG + Intergenic
989267235 5:39489754-39489776 TCAACAAGAGAGCTGGGTGAGGG - Intergenic
989951316 5:50301004-50301026 TTTCCAAATGACCTGAGTCATGG - Intergenic
994741067 5:103620036-103620058 TTTCCTTGAAACCTGGGTCAGGG - Intergenic
996884251 5:128337557-128337579 TTTCCATGAGAAGTGGGTTAAGG + Intronic
997398045 5:133580309-133580331 CTGCTGAGAGACCTGGGTGATGG - Intronic
1002214357 5:177619336-177619358 GTTCCATGAGAACTTGGTGAGGG - Intergenic
1003444448 6:6171896-6171918 TTTAACAGAGACCTGAGTGAAGG - Intronic
1004310547 6:14541110-14541132 TTTCCTACAGGCCTGGGGGAGGG + Intergenic
1004900198 6:20186431-20186453 TTTCCTGGAGCCCAGGGTGAGGG + Intronic
1005089056 6:22037296-22037318 TTTCCAAGGGACATGGGACACGG + Intergenic
1005497372 6:26399838-26399860 TTTCCCAGAGTTCTGTGTGAAGG + Intergenic
1005755220 6:28920084-28920106 GTTGCAAGAGAACTGGGTGATGG + Exonic
1006174260 6:32112463-32112485 TTGCCTAGAGACATGGGTGTGGG + Intronic
1007335736 6:41153880-41153902 TTTCTCACAGACCTGGGTGGGGG - Exonic
1009449928 6:63789057-63789079 CTTCCAAGAGGGCTGGCTGAAGG - Exonic
1014849194 6:126320132-126320154 TTTACCAGAGACCAGGGAGAAGG - Intergenic
1014886890 6:126792976-126792998 TTCCCAAGAGACCAGGTTGAAGG + Intergenic
1015413172 6:132917576-132917598 GTTCCCAGAAATCTGGGTGATGG + Intergenic
1015957628 6:138614929-138614951 TTTCCCACAGACCTGGGGTAGGG - Intronic
1017555493 6:155561819-155561841 TTTCCCAGAGACAGGGGTGCAGG - Intergenic
1019333463 7:471621-471643 TTTCCGACTGACCTGGGTGGGGG + Intergenic
1020417640 7:7964458-7964480 TTCTCAAGAGACCTGTGTAAAGG - Intronic
1023803020 7:43851128-43851150 TTTCCAGGAGACCTGAAGGAAGG - Intergenic
1024032150 7:45470299-45470321 TTTCCAAGAGGGCTGAGTAAGGG + Intergenic
1024571362 7:50725223-50725245 TTGCCACGAGACCTGGTTGTTGG + Intronic
1024835669 7:53515103-53515125 TTGCAAGGAGGCCTGGGTGACGG + Intergenic
1028574561 7:92332769-92332791 TTTCCAAAAGTCTTGGGAGAAGG - Intronic
1029625387 7:101717628-101717650 TTCCCAAGAGAACAGGGTGAGGG - Intergenic
1029712654 7:102308128-102308150 TGTCCCAGAGACCTGGGTTCAGG + Intronic
1030415396 7:109237561-109237583 CTTCCTAGAGACCTGTGGGATGG + Intergenic
1031141143 7:117944918-117944940 TTTCCTATAGCCCTGGATGAAGG - Intergenic
1036604869 8:10295799-10295821 AGTCCATGAGACCTGGGAGAGGG - Intronic
1040605946 8:48931436-48931458 CTTCCCAGAGTCCTGGGTGGGGG + Intergenic
1044514046 8:93117858-93117880 TTTACAGAAGACATGGGTGATGG + Intergenic
1045140887 8:99281042-99281064 TTTTCAATAGACTTGGGTGGTGG + Intronic
1048244067 8:132775066-132775088 TTGCCAAGGGTCCTGGGTAAAGG + Intergenic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1052553297 9:29980778-29980800 ATTCCAAGAGACCCTGCTGATGG + Intergenic
1052872471 9:33521669-33521691 TTTCCCAGAGACTGGGGAGAGGG - Intergenic
1053199331 9:36142081-36142103 TTTCCAGCATACCTGGCTGAGGG - Intronic
1056928788 9:90857720-90857742 TCTCAAAGAGAGCTGGGAGAGGG - Intronic
1057442840 9:95094490-95094512 CTTCCCAGGGACCTGGGGGAGGG - Intergenic
1057624928 9:96668427-96668449 TTTCCAAGAGTTCTAGGAGATGG - Intergenic
1058450144 9:105088910-105088932 TTTCCAAGGGAGCCAGGTGAAGG - Intergenic
1059045991 9:110867374-110867396 TTTCCAAGAGTCCAGGAAGAAGG + Intergenic
1061747715 9:132752655-132752677 ATTCCAGGAGAGCTGGGGGAAGG - Intronic
1203626037 Un_KI270750v1:23972-23994 TTTTCAAGTGACATAGGTGATGG - Intergenic
1185632971 X:1529327-1529349 TCTCCCTGAGACCTGGGGGATGG + Intronic
1186525290 X:10242655-10242677 TTGCCAAGTGTCCTGGGTGGGGG + Intergenic
1186580541 X:10813094-10813116 CCTCCAAGAGACCTGAGTGAAGG - Intronic
1186591821 X:10938677-10938699 TTTTTAAGAGACAAGGGTGAAGG - Intergenic
1187194568 X:17070842-17070864 TTTCAAAGAGAGATGGGTGGAGG + Intronic
1187298308 X:18024193-18024215 TTTCCAAAATACTTGGGTAATGG - Intergenic
1188942164 X:36253834-36253856 GTTCCAAGAGTTCTGGGTGAGGG - Intronic
1189316330 X:40059378-40059400 TTGCCAAAAGACCTGAGTTATGG - Intronic
1191671120 X:63749950-63749972 TTTCCAAGAATCCTTGATGAAGG - Intronic
1195235947 X:102898379-102898401 GTGCCAAGAGACCTGTGTGTAGG + Intergenic
1195236714 X:102906490-102906512 ATGCCAAGAGACCTGGGTGTAGG + Intergenic
1195240814 X:102949973-102949995 GTACCAAGAGACATGGGTGTAGG + Intergenic
1195301627 X:103535774-103535796 GTACCAAGAGACCTGGGTGTAGG - Intergenic
1195705058 X:107732469-107732491 GTCCCTAGAGGCCTGGGTGATGG - Intronic