ID: 1157828878

View in Genome Browser
Species Human (GRCh38)
Location 18:50838344-50838366
Sequence CATTGAGCCCAAAGGAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157828878_1157828880 6 Left 1157828878 18:50838344-50838366 CCTACTTTCCTTTGGGCTCAATG No data
Right 1157828880 18:50838373-50838395 CACTCTTTTTTTTTCCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157828878 Original CRISPR CATTGAGCCCAAAGGAAAGT AGG (reversed) Intergenic
No off target data available for this crispr