ID: 1157831368

View in Genome Browser
Species Human (GRCh38)
Location 18:50859779-50859801
Sequence CCTGCAGAGGAGGAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157831368_1157831373 -1 Left 1157831368 18:50859779-50859801 CCTTCCATCTCCTCCTCTGCAGG No data
Right 1157831373 18:50859801-50859823 GTTTTCCCTCTGCCTGCCCTAGG No data
1157831368_1157831374 0 Left 1157831368 18:50859779-50859801 CCTTCCATCTCCTCCTCTGCAGG No data
Right 1157831374 18:50859802-50859824 TTTTCCCTCTGCCTGCCCTAGGG No data
1157831368_1157831375 1 Left 1157831368 18:50859779-50859801 CCTTCCATCTCCTCCTCTGCAGG No data
Right 1157831375 18:50859803-50859825 TTTCCCTCTGCCTGCCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157831368 Original CRISPR CCTGCAGAGGAGGAGATGGA AGG (reversed) Intergenic
No off target data available for this crispr