ID: 1157835218

View in Genome Browser
Species Human (GRCh38)
Location 18:50895359-50895381
Sequence ATCTAGACCTAGAATTTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157835218 Original CRISPR ATCTAGACCTAGAATTTTAA TGG (reversed) Intronic
906016810 1:42589250-42589272 ATTCAGACCTAAAATTTTTATGG - Intronic
907212019 1:52832070-52832092 ATCTAGAGCTTGATTTTGAAAGG + Intergenic
908218623 1:61980934-61980956 AGCTGAACCTAGAATTTCAAGGG - Intronic
909367556 1:74845256-74845278 GTCAAGACCTATAATTTTCAGGG - Intergenic
910756910 1:90703883-90703905 TTCTTGACCTTCAATTTTAATGG - Intergenic
912677387 1:111696679-111696701 ATCTGTACCTAAAATTCTAAGGG + Intronic
913507260 1:119528367-119528389 GTCAAGACCTAGAATGTTACGGG + Intergenic
913955481 1:143286948-143286970 AGCTCGACCTAAAATTATAAGGG - Intergenic
913981950 1:143528497-143528519 AGCTCGACCTAAAATTATAAGGG + Intergenic
915779301 1:158528671-158528693 ATCAAAACCTTGAATTTAAATGG + Intergenic
916549494 1:165836478-165836500 ATTTTGACATATAATTTTAAAGG - Intronic
917001020 1:170359285-170359307 ATCTGGTCCTGGAATTTTTAGGG - Intergenic
920228063 1:204452140-204452162 ATCCCCACCTTGAATTTTAAAGG - Intronic
920777105 1:208950213-208950235 ATCTACACATAGATTTTTGATGG + Intergenic
922063216 1:222111321-222111343 ATCCAGACCCAGAATTTAAAGGG - Intergenic
922066087 1:222145277-222145299 ATGTAGGCCTAGTATTTGAAAGG - Intergenic
923965787 1:239137238-239137260 ATCCAAACCTAAAATCTTAAAGG - Intergenic
924109668 1:240685651-240685673 ATCTGGGCCTAGAATTTTGTCGG - Intergenic
924355818 1:243174447-243174469 TTCTAGACATAAAGTTTTAATGG + Intronic
1064964135 10:20998584-20998606 ATGTAGACGTAGCATTTTTATGG - Intronic
1065713014 10:28534168-28534190 AACCAAACCTGGAATTTTAAGGG - Intronic
1068061639 10:52075405-52075427 ATGTGGACCTAGAATTTATATGG + Intronic
1069727213 10:70588128-70588150 ATCTACACCTAAAATTTTTCAGG - Intergenic
1071884832 10:89938310-89938332 AGCATGACCTGGAATTTTAATGG + Intergenic
1074689796 10:115993812-115993834 ATGTAGACCTTAAACTTTAATGG - Intergenic
1078768214 11:14320428-14320450 ATCAAGACAAAAAATTTTAATGG + Intronic
1080965813 11:37212959-37212981 TTCTCTACCTAGTATTTTAATGG + Intergenic
1082698463 11:56399849-56399871 ATCTAGAGCTTGATTTTGAAAGG + Intergenic
1083566532 11:63723237-63723259 AGTTAGACCAAGAAGTTTAAAGG + Intronic
1085136594 11:74095216-74095238 ATCTAAACCTACCATTTTCAAGG + Exonic
1089878178 11:121746320-121746342 ACCTACAGCTAGACTTTTAAAGG + Intergenic
1092968785 12:13671669-13671691 ATTTAGACATAGAAGTTTACTGG - Intronic
1093222438 12:16438865-16438887 ATCTAAACCTAGCACATTAAGGG - Intronic
1093823542 12:23652740-23652762 ATGTAGACCTAGGAGTTTAAAGG - Intronic
1094047219 12:26180255-26180277 ATCTAGATCTTGAATTTGCAAGG - Intronic
1094270125 12:28604862-28604884 TTCTAGACATACATTTTTAAAGG - Intergenic
1096929813 12:55195131-55195153 ATGAAGACTTATAATTTTAAAGG + Intergenic
1096999655 12:55865456-55865478 GTCTAGACCTGGAAATCTAAAGG + Intergenic
1098985977 12:77012782-77012804 ATCTATACAGATAATTTTAAGGG - Intergenic
1099199824 12:79662527-79662549 GTCTAGAACTAGAATGTGAATGG - Intronic
1099327116 12:81231337-81231359 CTCTAGACATAGAAATTTATTGG + Intronic
1099602679 12:84761487-84761509 CTCTAGGCCTAGAATCTTCAGGG - Intergenic
1099767955 12:87013718-87013740 ATTTATACTTAAAATTTTAATGG + Intergenic
1101037382 12:100718410-100718432 ATCTAGATTTGGCATTTTAAAGG + Intronic
1101189306 12:102314763-102314785 ATCTAGAGCTTGATTTTGAAAGG - Intergenic
1101971994 12:109321239-109321261 CTCTAGACCTAGAATACAAATGG + Intergenic
1105289648 13:19043782-19043804 ATTTAGACCTAACATTTTCATGG - Intergenic
1108171512 13:47746796-47746818 ATCTGCACCTAGATGTTTAATGG + Intergenic
1109107159 13:58267850-58267872 AGCTAGACCTTGATTTTTATAGG + Intergenic
1109111427 13:58325019-58325041 AAATAGACCTAGAATTCTCATGG + Intergenic
1109358860 13:61269946-61269968 ATCTAGTCCTGGACTTTTATTGG - Intergenic
1109474238 13:62857472-62857494 ATCTATACCTCCACTTTTAAGGG + Intergenic
1109631155 13:65048234-65048256 ATCAAGACTTACAGTTTTAATGG + Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1114766989 14:25384313-25384335 AGCTAGACCAAGAATCTAAAAGG - Intergenic
1115720779 14:36158874-36158896 ATCTAGTCCTTGAATTTTTTTGG + Intergenic
1116679214 14:47944418-47944440 ATCTAGAGCTTGATTTTTAAAGG - Intergenic
1117748493 14:58896498-58896520 ATCAAGAAAAAGAATTTTAAAGG - Intergenic
1117894638 14:60470461-60470483 ATCTGTACCTAACATTTTAATGG - Intronic
1120299341 14:82686345-82686367 ATCTATGGCTAGAATTTTAATGG + Intergenic
1121386996 14:93537007-93537029 GTCTTCACCTAGAATTTAAAGGG - Intronic
1125287329 15:38107832-38107854 ATCAAGACATGCAATTTTAAGGG + Intergenic
1125844172 15:42835980-42836002 ATCTAGACCTACAGTTGTACTGG + Intronic
1126461963 15:48924032-48924054 TTCTAGGCCTAGAATTTCATGGG + Intronic
1127168095 15:56268946-56268968 ATCTGGTCCTAGAATTTTTTTGG + Intronic
1131441068 15:92460132-92460154 ATATAGTCATAGAGTTTTAAAGG - Intronic
1135962386 16:27007469-27007491 ATCTAGAACTAAAATTGTAATGG + Intergenic
1140660358 16:77185222-77185244 ATCTAGGCCTGGAATTTTTATGG + Intergenic
1144244316 17:13347928-13347950 ATCCAGACCTTGGACTTTAATGG - Intergenic
1144667132 17:17109684-17109706 ATCCAGATCTTGATTTTTAATGG + Intronic
1146251951 17:31354200-31354222 ATCAAGACATATCATTTTAATGG - Intronic
1146272521 17:31493675-31493697 ATCTAGACCTAGAAGTTTTCTGG - Intronic
1146594418 17:34156722-34156744 ATCAAGAGCTAGAGTTTGAATGG - Intronic
1148404865 17:47402505-47402527 ATCTACACATGTAATTTTAAGGG + Intronic
1149652255 17:58282753-58282775 ATCAAGCTCTAGAATTTTAGAGG + Intergenic
1150127749 17:62649226-62649248 ATCTTTGGCTAGAATTTTAAAGG + Intronic
1150871289 17:68914118-68914140 TTCTACACCTAGATTTTTGAGGG - Intronic
1151074915 17:71259977-71259999 ATACAGACCTAGTATTTTCAAGG + Intergenic
1151410439 17:73923221-73923243 TTCCAGACATAGATTTTTAATGG - Intergenic
1151916864 17:77124617-77124639 ATGTAGACCTAAATATTTAAAGG + Intronic
1153500867 18:5748526-5748548 GTGTAGACCTAAACTTTTAAAGG + Intergenic
1156794596 18:41028161-41028183 ATCTGGACATAGAGTTTTGAAGG - Intergenic
1156832352 18:41507482-41507504 TGCTAGATATAGAATTTTAAAGG + Intergenic
1156872201 18:41958589-41958611 ATCGAAACCAAGTATTTTAATGG + Intronic
1157168390 18:45379587-45379609 ATCCAGACTGAGCATTTTAAAGG - Intronic
1157835218 18:50895359-50895381 ATCTAGACCTAGAATTTTAATGG - Intronic
1159963808 18:74576968-74576990 ATCTAGACCTAGAAGAATACCGG + Exonic
1160083361 18:75752181-75752203 TTATAGAACTAGTATTTTAATGG + Intergenic
1164024854 19:21342621-21342643 TTCTATACCTATAATTTTATGGG - Intergenic
925088884 2:1136859-1136881 AACTGTACCTAGAATATTAAAGG - Intronic
925526192 2:4805024-4805046 ATGTAGGCCTAGGATTATAAAGG - Intergenic
927770033 2:25852238-25852260 ATTTAAAGCTAGATTTTTAAAGG + Intronic
928362241 2:30674412-30674434 ATCTAGTCCTGAAATTTTATAGG - Intergenic
929722247 2:44382318-44382340 ATCTCTACCTAGAATCTTATAGG + Intronic
930917004 2:56704587-56704609 ATATAGACCTAAAATATAAATGG + Intergenic
932333596 2:70915982-70916004 ATTTAAACCTATAATTTTATAGG - Intronic
932505500 2:72226624-72226646 AAGTAAACCTAGATTTTTAAAGG - Intronic
936779645 2:116016716-116016738 TTCTAGACTCAGAATTGTAAGGG - Intergenic
938389808 2:130896129-130896151 ATCAAGACCTGGCAATTTAATGG - Intronic
939265261 2:139864823-139864845 ATCTAGACCTTGTATTTGTATGG + Intergenic
939389923 2:141554770-141554792 ATGTAGACCACTAATTTTAAAGG - Intronic
940517933 2:154704655-154704677 ATGTAGACCTAGAATTTTATTGG - Intronic
941527412 2:166623344-166623366 TTCTATACCTAGTTTTTTAAGGG + Intergenic
942176810 2:173342529-173342551 CTCTTGAGCTAGAATTTGAAAGG - Intergenic
943229262 2:185225469-185225491 ATATATACATAGATTTTTAATGG + Intergenic
943602197 2:189934559-189934581 ATTTAAATCTAGAATTTTAAGGG + Intronic
943623329 2:190173772-190173794 TTCTCGATCTTGAATTTTAAAGG - Intronic
945704367 2:213210824-213210846 ATCTAGAGCTTGATTTTGAAAGG + Intergenic
1169038709 20:2475346-2475368 ATCTAGACACAGAAATCTAATGG - Intronic
1170292787 20:14789160-14789182 ATATAGGCCTAAATTTTTAATGG - Intronic
1174322025 20:49749539-49749561 ACCTAGACCTGGAATTTGCAGGG + Intergenic
1177326868 21:19601971-19601993 ATGTAGGCAAAGAATTTTAATGG - Intergenic
1179230675 21:39501006-39501028 ATCTTGACCTAGAAGTTAGACGG + Intronic
950604899 3:14070036-14070058 ATCTAGAGCTTGATTTTGAAAGG + Intronic
951073995 3:18367002-18367024 ACACAGACCTAGAACTTTAAGGG + Intronic
953828048 3:46271192-46271214 TTCTAGAGCTAAAATTCTAAAGG + Intergenic
954982499 3:54759300-54759322 TTCAAGACCTAGAATTTAACAGG + Intronic
955588659 3:60510441-60510463 TTCTAGGCCTTGAATTTGAATGG + Intronic
957503152 3:81083551-81083573 ATTTAGAACTATAATTTTGAAGG + Intergenic
957818036 3:85328737-85328759 CTCTAGACTTAGTATTTTCAAGG - Intronic
957966469 3:87327823-87327845 TTCTATACCTAGTTTTTTAAGGG - Intergenic
958143001 3:89587589-89587611 AGGTAGACCTAGAATTGTCAGGG + Intergenic
958267087 3:91450635-91450657 ATTTACACATAGAATTTTATTGG - Intergenic
958705575 3:97650233-97650255 ATAGAGACCCAGAATCTTAATGG + Intronic
959306972 3:104679850-104679872 TTCTATACCTAGATTTTAAAGGG - Intergenic
959434940 3:106303150-106303172 ATATAGGCCCAGAATTTTAACGG - Intergenic
960925142 3:122787968-122787990 TTCTAGACCTTGAAATTCAAAGG - Intronic
962055303 3:131865327-131865349 ATCTGGTCCTAGAATTTTTTTGG + Intronic
963644983 3:147902936-147902958 ATCTAGAACCAGGTTTTTAAAGG + Intergenic
964363480 3:155923791-155923813 ATATAGCCCTAGAATTTAATTGG + Intronic
965188293 3:165494565-165494587 ATTTAGTTCTAGAATTTTATGGG + Intergenic
965982355 3:174708768-174708790 GTTTAGACCTAGGAATTTAAAGG + Intronic
966040487 3:175480266-175480288 CACTAGACCTAAAATTTTCATGG - Intronic
967492308 3:190107614-190107636 AGCTTCACCTAGAATTTCAAAGG + Intronic
967646701 3:191933087-191933109 ATCTTAACCTTAAATTTTAAGGG - Intergenic
972310410 4:37877053-37877075 ATTTAGATCTTGAATTTAAATGG - Intergenic
973875053 4:55209303-55209325 ATCTAGTCCTGGACTTTTTATGG - Intergenic
974166445 4:58210903-58210925 AGCTAGAACTAGAATTTATATGG + Intergenic
974928604 4:68333999-68334021 ATTTATCCCTACAATTTTAATGG + Intronic
975427955 4:74252810-74252832 ATATAGACATAACATTTTAAGGG + Intronic
975921320 4:79393550-79393572 ATCTAAGCCTAGAATTCTGAAGG - Intergenic
977057248 4:92208714-92208736 CTCTAAATCTAAAATTTTAATGG + Intergenic
977271735 4:94925623-94925645 ATATGGACTTAGAATTTTTAAGG - Intronic
979245994 4:118505184-118505206 TTCTAGACATAAAGTTTTAATGG - Intergenic
979727451 4:123980428-123980450 ATGTAGGCCTAGAATTTTCTTGG - Intergenic
980839022 4:138234320-138234342 ATCTAAAGGTATAATTTTAATGG + Intronic
981068005 4:140505847-140505869 ATCTAGACCGGGAGTTTTTAGGG + Intergenic
981626931 4:146767923-146767945 ATCCAACCCTTGAATTTTAAAGG - Intronic
982140292 4:152310877-152310899 ATTTTGATCTAGAATTTCAAGGG + Intergenic
984431262 4:179652089-179652111 ATCTAGACTAAGAATTTTCTTGG + Intergenic
984440043 4:179756780-179756802 ATTTAGAGTTAGAATTTTAAAGG - Intergenic
984563145 4:181294697-181294719 ATCATCACCTAGAAATTTAAAGG + Intergenic
986487263 5:8250248-8250270 ATCTAGGAATAGAATTTCAAGGG + Intergenic
988904019 5:35766249-35766271 ATCTAGAACTAAAGTTTTATAGG + Intronic
993283512 5:85959374-85959396 TTGTAGAGCTAGCATTTTAATGG - Intergenic
994227019 5:97264806-97264828 ATCTAGAGTTAGAAGTTTTATGG - Intergenic
994946247 5:106395945-106395967 GTTTAGAGCTAGAATTTTGAAGG - Intergenic
996688656 5:126313316-126313338 AGCTAGACCCAGAATTTCATTGG - Intergenic
996996970 5:129708809-129708831 ATCATTTCCTAGAATTTTAAAGG - Intronic
998640012 5:143998666-143998688 GATTAGAACTAGAATTTTAAGGG + Intergenic
1000945898 5:167422451-167422473 ATATATACCTAACATTTTAAGGG + Intronic
1002022087 5:176370030-176370052 ATCTAGAGCCAGAATTTGCAAGG - Intronic
1004807355 6:19218610-19218632 GTCAAGAAGTAGAATTTTAAAGG + Intergenic
1006243891 6:32712828-32712850 ACCTTCTCCTAGAATTTTAATGG - Intergenic
1006819641 6:36882274-36882296 ATCTAGAGCTTGATTTTGAAAGG - Intronic
1008193218 6:48485883-48485905 ATATAGAAATAGAATTTTAAAGG + Intergenic
1008988127 6:57570973-57570995 ATTTACACATAGAATTTTACTGG + Intronic
1009727553 6:67554980-67555002 ATCTAGTCCTGGAATTTTTTTGG + Intergenic
1009903491 6:69838986-69839008 ATCTAGATCAGAAATTTTAAGGG + Intergenic
1011467274 6:87671141-87671163 AACAAGACTTAGACTTTTAAAGG + Intergenic
1012374613 6:98546744-98546766 AACTAGACTTAGAACTTTGAAGG + Intergenic
1014973185 6:127844494-127844516 ATCTGGCCTTATAATTTTAAGGG + Intronic
1015258406 6:131206608-131206630 ATACAGAACTAGAATTGTAATGG + Intronic
1017552630 6:155525403-155525425 ATCTAGCAATAGAATTTTATAGG - Intergenic
1018348198 6:162925184-162925206 ATCTGGTCCTGGACTTTTAATGG - Intronic
1020674068 7:11158714-11158736 ATCAAGTCATAGAATATTAAAGG - Intronic
1022863543 7:34393110-34393132 ATCTAGACCTCAAAATCTAAAGG - Intergenic
1023134500 7:37037863-37037885 ATTTAGTACTAAAATTTTAAGGG - Intronic
1023259021 7:38340210-38340232 ATCTAGGCCTAGTGTTTTAGTGG + Intergenic
1024944595 7:54796110-54796132 ATCTAGAGAGAGAATTTTTATGG - Intergenic
1027520440 7:79200113-79200135 ATCTAGACCAGGAATTTTCCTGG - Intronic
1027960997 7:84945030-84945052 ATCTAGAGCTTGATTTTGAAAGG - Intergenic
1031371641 7:120974983-120975005 ATCTTGAACTTGAATTTTATGGG + Exonic
1032291878 7:130596367-130596389 ATCTAGGCCTATTGTTTTAAGGG + Intronic
1032565851 7:132942100-132942122 ATATAGGCCTAGAATTGTATAGG - Intronic
1034005744 7:147470126-147470148 AACAAGACTTAGACTTTTAAAGG + Intronic
1034924805 7:155112715-155112737 TTCTAGAACTAGATGTTTAAAGG + Intergenic
1036038051 8:5041716-5041738 AACTACATCTAGCATTTTAAAGG - Intergenic
1036736892 8:11327165-11327187 ATCCAGTCCTAGAATTTCAGAGG - Exonic
1038466966 8:27773136-27773158 CTCCAGACCTAGTAATTTAAAGG - Intronic
1039530835 8:38260396-38260418 ATCTAAACTCAGAGTTTTAATGG + Intronic
1040351113 8:46569414-46569436 ATCTAAAATTAGAAATTTAAAGG + Intergenic
1041629832 8:60074676-60074698 ATCTTGAGATAGAATTGTAATGG - Intergenic
1044096937 8:88078430-88078452 ATCACGAGCCAGAATTTTAAAGG - Intronic
1044119062 8:88371646-88371668 ATCCAGACCTAGATGTATAATGG - Intergenic
1044454150 8:92372765-92372787 AACTTGACCTTGAATTTTACTGG - Intergenic
1045703479 8:104894015-104894037 ATCTCCAAATAGAATTTTAATGG + Intronic
1046598763 8:116293244-116293266 ATCAAGAGCTAAAATATTAAAGG + Intergenic
1047768922 8:128014729-128014751 ATCTAGAACTTCAATTTCAATGG - Intergenic
1049046714 8:140157971-140157993 TTCTAGACCTTTATTTTTAATGG + Intronic
1050567925 9:6906102-6906124 ATACAGACATAGAATTTCAAAGG + Intronic
1050657995 9:7850441-7850463 ATCTAGAGCTTGACTTTGAAAGG - Intronic
1054745812 9:68852888-68852910 ATCAAGACATTGAATTTTAGGGG + Intronic
1056245295 9:84688647-84688669 ATTTAGACCCAGAACTTTCAGGG - Intronic
1058077198 9:100663008-100663030 ATTTAGACCCAGAATTTTGTGGG + Intergenic
1186008267 X:5099376-5099398 ATATAGACCCAGAATTTACAAGG + Intergenic
1186265557 X:7829646-7829668 ATTTAAAACTAGAATTTTTATGG + Intergenic
1188676792 X:32951347-32951369 TTCTAGACATATAATTTTAAGGG + Intronic
1191896843 X:66001783-66001805 ATCTAGACATAGAATGTTGTAGG - Intergenic
1193570213 X:83132147-83132169 ATCTAGTCCTGGACTTTTTATGG - Intergenic
1194613314 X:96070901-96070923 ACCTAGACCTTGAATTTGAAAGG + Intergenic
1195272995 X:103251502-103251524 ATCTATACATAAAATTTAAAAGG - Intergenic
1196507950 X:116471271-116471293 TTCTATACCTAGATTTTTGATGG + Intergenic
1198498416 X:137217626-137217648 ATCTAGAGCTTGATTTTGAAAGG - Intergenic
1201705460 Y:16931866-16931888 ATCTGGTCCTGGAATTTTTATGG - Intergenic