ID: 1157842065

View in Genome Browser
Species Human (GRCh38)
Location 18:50968044-50968066
Sequence CCCCGCGGACAGCTGGGCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 173}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157842059_1157842065 -8 Left 1157842059 18:50968029-50968051 CCGGGCGCATTGTAGCCCCGCGG 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1157842065 18:50968044-50968066 CCCCGCGGACAGCTGGGCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 173
1157842058_1157842065 -7 Left 1157842058 18:50968028-50968050 CCCGGGCGCATTGTAGCCCCGCG 0: 1
1: 0
2: 0
3: 0
4: 22
Right 1157842065 18:50968044-50968066 CCCCGCGGACAGCTGGGCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 173
1157842052_1157842065 15 Left 1157842052 18:50968006-50968028 CCCGGCCGGCGGCGCACTTCCGC 0: 1
1: 0
2: 0
3: 10
4: 70
Right 1157842065 18:50968044-50968066 CCCCGCGGACAGCTGGGCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 173
1157842053_1157842065 14 Left 1157842053 18:50968007-50968029 CCGGCCGGCGGCGCACTTCCGCC 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1157842065 18:50968044-50968066 CCCCGCGGACAGCTGGGCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 173
1157842051_1157842065 25 Left 1157842051 18:50967996-50968018 CCGCGCGGGACCCGGCCGGCGGC 0: 1
1: 0
2: 3
3: 23
4: 218
Right 1157842065 18:50968044-50968066 CCCCGCGGACAGCTGGGCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 173
1157842055_1157842065 10 Left 1157842055 18:50968011-50968033 CCGGCGGCGCACTTCCGCCCGGG 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1157842065 18:50968044-50968066 CCCCGCGGACAGCTGGGCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 173
1157842057_1157842065 -4 Left 1157842057 18:50968025-50968047 CCGCCCGGGCGCATTGTAGCCCC 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1157842065 18:50968044-50968066 CCCCGCGGACAGCTGGGCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157842065 Original CRISPR CCCCGCGGACAGCTGGGCCA GGG Exonic
900111049 1:1005802-1005824 CCCCCAGGACAGCTGGGCCTGGG + Intergenic
900356617 1:2268122-2268144 CCCAGGGGGCACCTGGGCCAGGG - Intronic
901167137 1:7229112-7229134 CCCCAGGGACAGCAGGGCCTGGG + Intronic
901791278 1:11654805-11654827 CCCCGCGCAGCGCTGGGCCAGGG - Intronic
901890346 1:12258286-12258308 GCCCGAGGAGAGCCGGGCCATGG + Intronic
903652733 1:24931288-24931310 GACCGCGGACAGCTTCGCCAAGG + Intronic
905449578 1:38047622-38047644 CCGCGCGGGCAGCTGGGGCTGGG + Intergenic
909043927 1:70686563-70686585 CCCTGCTGGCTGCTGGGCCAGGG - Intergenic
919986840 1:202681443-202681465 CCCTGCTGCCAGCGGGGCCATGG - Intronic
923623334 1:235595098-235595120 CCCCGAGGGCTGCTGGGCCTTGG - Intronic
1063472024 10:6295671-6295693 CCCCCAGGCCAGCTGGGCCTTGG + Intergenic
1070539823 10:77408036-77408058 CACCCAGGACAGCTGGGGCAGGG + Intronic
1070824074 10:79380791-79380813 CCCCGGGGAGAGCTGGGGCTTGG + Intergenic
1071527769 10:86367772-86367794 CTCCGCGGACAACAGGGCCCGGG - Intergenic
1073514960 10:104068044-104068066 CCCCTCCGCCAGCAGGGCCATGG - Intronic
1076183100 10:128425976-128425998 CCCTGTGGACAGCTTGGTCATGG - Intergenic
1076363947 10:129910122-129910144 CCACTCGGACCGCCGGGCCAGGG + Intronic
1076631767 10:131856057-131856079 CCCTGGGGACAGGCGGGCCATGG - Intergenic
1076821168 10:132940464-132940486 CCTAGCGGACAACTTGGCCAAGG - Intronic
1077257968 11:1597557-1597579 CCCAGAGGAGAGCTGAGCCATGG + Exonic
1077303077 11:1856048-1856070 ACCCCCGGGCAGCTGGGCCAAGG - Intronic
1077408612 11:2393411-2393433 CACCTGGGACAGCTGGACCAGGG - Intronic
1077443359 11:2578868-2578890 CCAGGCAGACAGCTGGACCAAGG - Intronic
1079369904 11:19842665-19842687 CTCCAGGGACAGCTGGGGCAAGG - Intronic
1082028862 11:47590759-47590781 CCCAGCGGCCTGCTGGGCCCTGG - Exonic
1082215291 11:49560951-49560973 CCCCCCGAAAAGTTGGGCCACGG - Intergenic
1083607632 11:63988266-63988288 CACTGCAGGCAGCTGGGCCAGGG - Intronic
1083894104 11:65611611-65611633 CCCTGCAGGCAGCTGGGCTAGGG + Intronic
1084199364 11:67545156-67545178 CACAGCGGGCAGGTGGGCCAAGG - Intergenic
1084804018 11:71566335-71566357 CCCAGTGGAGAGCTGAGCCATGG - Exonic
1086634280 11:89063526-89063548 CCCCCCGAAAAGTTGGGCCACGG + Intronic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1089359462 11:117876445-117876467 CTCCGCGGTCAGCTGCGCCGCGG - Intronic
1090647543 11:128777843-128777865 CATCGGGGACACCTGGGCCAGGG - Intronic
1091178057 11:133579444-133579466 CCCCGAGCACAGCAGGGGCACGG - Intergenic
1101584268 12:106070888-106070910 CCAGGTGGACAGCTGGGCCCTGG - Exonic
1101700484 12:107169297-107169319 CCCCGCCCCCAGCTGGCCCAGGG - Intergenic
1103209596 12:119156803-119156825 CCCCACGGGCAGCTGGCTCAGGG - Exonic
1103261962 12:119595269-119595291 CCTCGCCTGCAGCTGGGCCACGG + Intronic
1104755499 12:131266772-131266794 CCTCGTGGACAGCAGGCCCAAGG + Intergenic
1104795375 12:131513453-131513475 CCCCGTGGACAGCCAGGGCATGG - Intergenic
1113074493 13:106454547-106454569 CACCCCAGACAGATGGGCCATGG - Intergenic
1113617469 13:111691251-111691273 CCCCTGGGACAGCTTGGCCAGGG + Intergenic
1113622999 13:111776511-111776533 CCCCTGGGACAGCTTGGCCAGGG + Intergenic
1115017410 14:28633840-28633862 CCCTGCTGACAGCTGGACCAGGG - Intergenic
1119499063 14:75107444-75107466 CTCCATGGTCAGCTGGGCCATGG - Exonic
1122577318 14:102750643-102750665 CCCCGCGGCCATCTGGACAAGGG - Intergenic
1122920537 14:104878155-104878177 CCCCGTGGACACCCTGGCCACGG + Intronic
1123995305 15:25713980-25714002 CCAGGCGGACAACTGGGCCTCGG - Exonic
1124269589 15:28268474-28268496 GACGGCGGACGGCTGGGCCATGG - Exonic
1124708906 15:31988642-31988664 CCCTGTGCACTGCTGGGCCAGGG - Intergenic
1125584073 15:40807882-40807904 CCCCGAGGGCTGCAGGGCCAGGG + Intronic
1126097864 15:45101935-45101957 CACCTCGGCCAGCTGGGCCTTGG + Exonic
1129116625 15:73368485-73368507 CCCCGCGCCCAGCCGGGCCCGGG - Exonic
1129688621 15:77700598-77700620 CCCCGCCTGCAGCTGGCCCAAGG - Intronic
1130067492 15:80616648-80616670 CCCCTCGGACAGGAGGGTCAGGG - Intergenic
1131049482 15:89337063-89337085 CCCTGTGGACAGTTGGGCCAGGG - Intergenic
1132581673 16:687551-687573 CCCCGAGGACAGGTGTGGCATGG - Exonic
1139437987 16:66947937-66947959 TCCCGCGGAGACCAGGGCCATGG - Intergenic
1142008082 16:87699778-87699800 TCCCGGGGACCGCTGGCCCATGG - Intronic
1143116531 17:4584587-4584609 CCGCGCGCTCTGCTGGGCCATGG + Exonic
1144685186 17:17221488-17221510 CCCCACGGCCATCCGGGCCAAGG + Intronic
1147945615 17:44078544-44078566 CCCCACCGACAGCAAGGCCATGG + Exonic
1151956220 17:77381449-77381471 CCACGTGGAAAGCGGGGCCAAGG - Intronic
1151977542 17:77491008-77491030 CCCAGCAGCCACCTGGGCCAGGG - Intronic
1152147059 17:78574722-78574744 CACCGCGATCAGCTGGTCCACGG + Exonic
1152711405 17:81871908-81871930 CCCCGCGGAAAGCTGGTGCTGGG + Intergenic
1152727752 17:81955994-81956016 CCCTGGGGAGAGTTGGGCCAAGG - Intronic
1153847512 18:9063115-9063137 CCCCGTGGACAGCTGGTGGAGGG - Intergenic
1156484684 18:37457264-37457286 CCTCGCTGCCAGCTAGGCCATGG + Intronic
1157842065 18:50968044-50968066 CCCCGCGGACAGCTGGGCCAGGG + Exonic
1158438262 18:57449994-57450016 CCCCATGGACTGCTGGTCCATGG + Intronic
1160847811 19:1174070-1174092 CCCCGCGGACCCCTGCGCCCGGG - Intronic
1160857293 19:1223329-1223351 CCCTGCGGGCCGCTGGGACATGG + Intronic
1161973480 19:7596379-7596401 CCCCGCGCGGAGCTGGGCCGCGG - Intronic
1162351006 19:10149455-10149477 CCCCTCCGAAAACTGGGCCATGG - Exonic
1162471901 19:10877122-10877144 TCCCCCTGACAGCTGGGGCAGGG + Intronic
1162535634 19:11261846-11261868 CCCCCCCGACAGCTGGGCACTGG + Intronic
1162957362 19:14106927-14106949 CCCCGCGGCCTGCTTGGCTAAGG + Intronic
1163696964 19:18768916-18768938 CCCCGTGGAGAGGTGGGCCCAGG - Intronic
1165073253 19:33267692-33267714 CCCGGCAGACAGCTGGGCTGGGG + Intergenic
1166096292 19:40541474-40541496 CCCAGGGGACAGCAGGGCCTTGG - Intronic
925170016 2:1744533-1744555 CCCCGCGCACAGCTGGGACGTGG - Intronic
926109772 2:10174343-10174365 CTCTGCTGACAGCAGGGCCAGGG - Intronic
929051029 2:37837007-37837029 CCCCAGGGACAGCTGCTCCATGG - Intergenic
929133665 2:38602739-38602761 CCCCGCGGACGGCCGGGCCGCGG - Exonic
929778115 2:44941102-44941124 CGCCACGGCCCGCTGGGCCAAGG + Intergenic
930766396 2:55089856-55089878 CCCCTGGGACACCTGGGGCATGG + Intronic
938288915 2:130139194-130139216 CCCTGCAGACAGCGGGGCCTGGG + Intergenic
938306002 2:130254249-130254271 CCCTGCGGACAGCAGGGGCTGGG + Intergenic
938448150 2:131393523-131393545 CCCTGCGGACAGCAGGGGCTGGG - Intergenic
938467619 2:131533737-131533759 CCCTGCAGACAGCAGGGCCTGGG - Intergenic
938776243 2:134544042-134544064 CCCAGGAGACAGCTGGGCCTGGG + Intronic
940517256 2:154698000-154698022 CCCCGCGCTCAGCTGAGACACGG - Intergenic
945102461 2:206274806-206274828 CTCCGCGGGCAGCGGGGCCGTGG + Exonic
947591509 2:231388662-231388684 CGCCCTGGACAGCTGGGCCCAGG - Intergenic
948591476 2:239053480-239053502 GCCCACGGACAGCGAGGCCATGG + Exonic
948790629 2:240374753-240374775 TCCCGGGGACTGCTGGGCCTTGG - Intergenic
1169066081 20:2694634-2694656 CTCTGCTGACAGCTGGGACAGGG + Intronic
1169073790 20:2749648-2749670 CCCCGGGGAGGGCTGGACCACGG + Exonic
1172798630 20:37560777-37560799 CACCTCTGACAGCTGGGGCAGGG - Intergenic
1172978877 20:38926441-38926463 GCCCTCGGACAGCAGAGCCATGG - Exonic
1176086256 20:63296859-63296881 CCCCCCGGAAAGCTGGGGCTCGG - Intronic
1179529638 21:42009925-42009947 CCCCAGGGGCAGCTCGGCCAGGG + Intronic
1179874646 21:44261819-44261841 CCCCGGGGAGGACTGGGCCATGG + Exonic
1179875804 21:44266808-44266830 CCCCGGGTCCAGCTGGGCCCAGG - Intergenic
1180074520 21:45455926-45455948 CCCCACTGAGAGCTTGGCCAGGG + Exonic
1180877525 22:19181636-19181658 CCTGGTGGACAGCTGGGCCTGGG - Intronic
1181437140 22:22917618-22917640 CCTTCAGGACAGCTGGGCCAAGG + Intergenic
1182828940 22:33289244-33289266 CACCGCGCCCAGCTGGACCAAGG + Intronic
1183278869 22:36921754-36921776 CCCCGTGGGCTGCTGGTCCACGG - Intronic
1183613573 22:38927507-38927529 CCTCTCCGACAGCTCGGCCAGGG - Intergenic
1185127534 22:49019871-49019893 CCCCTCGGACAGCAGGTCCCTGG + Intergenic
952967114 3:38628259-38628281 CCCCCAGGACAGCTGCCCCAGGG - Intronic
953385790 3:42505001-42505023 CCCCCCGGACAGCAGGCACAGGG + Intronic
962874154 3:139522921-139522943 CCAGGCGGGCAGGTGGGCCAGGG + Intronic
966915794 3:184583596-184583618 CGCCGCCGCCAGCTGTGCCAGGG - Intronic
968518157 4:1023466-1023488 TCCCAGGGACAGCTGGGCAAGGG - Intronic
969620256 4:8275333-8275355 CCCTGCCGAAAGCTGGGCCATGG + Intronic
969721535 4:8895133-8895155 CCCTGCAGAGGGCTGGGCCAAGG - Intergenic
984919100 4:184748355-184748377 GCCCACTGACAGCTGGGCCCGGG + Intergenic
985958598 5:3282680-3282702 GCCTGCAGACAGCTGGGCCTTGG + Intergenic
991720962 5:69493718-69493740 ACCCGCGCCCAGCCGGGCCACGG + Intronic
997025973 5:130061719-130061741 CCCCACTGAAAGCTGGGCAAAGG + Intronic
998130621 5:139649535-139649557 CCCCGCGGGCAGCGGGGGCGAGG - Intronic
1001673106 5:173490852-173490874 CCCCAGAGACAGCTGGGGCATGG + Intergenic
1002183419 5:177442950-177442972 TCCCGCTTCCAGCTGGGCCAGGG - Intergenic
1003065855 6:2903168-2903190 CCCCGCGCACGGCTGGGGTAGGG - Intronic
1003468189 6:6401617-6401639 CCCAAGGGACAGCTGGGGCATGG + Intergenic
1003500654 6:6700268-6700290 CTCCTCTGAAAGCTGGGCCAAGG + Intergenic
1004522585 6:16376002-16376024 TCCCGCAGGCAGCTGTGCCATGG - Intronic
1009381132 6:63031507-63031529 ATCCGCTGACAGCTGGACCATGG - Intergenic
1012997984 6:105992647-105992669 CCGCGCGCAGAGCTGGGCCTGGG + Intergenic
1018834629 6:167473642-167473664 CCCAGGTGGCAGCTGGGCCACGG + Intergenic
1018862443 6:167720838-167720860 CCACGCGGACTGCTGGGCCACGG - Intergenic
1019008816 6:168825609-168825631 CCCCACGGTCAGCAGAGCCACGG + Intergenic
1019330414 7:458077-458099 CCCCGTGGACAGTGGGGCCTAGG - Intergenic
1019734065 7:2641806-2641828 CCCCGCAGACAGCTGGGCTCAGG + Intronic
1023810401 7:43906743-43906765 GCCCGGGGACAGCTGGGGCGGGG + Exonic
1026901439 7:74039593-74039615 CCCCGCTGAGAGCTGAGGCAGGG - Intronic
1026959108 7:74397335-74397357 CCCCAGGGACAGCTGAGTCATGG + Intronic
1026962643 7:74418266-74418288 CCCCACGCACAGCTGTGCCTCGG + Intergenic
1026981888 7:74531764-74531786 CCCTGCAGATACCTGGGCCAGGG - Intronic
1030007414 7:105132799-105132821 CCCTGCGGACATCTGGAGCACGG - Exonic
1030205950 7:106952960-106952982 CCACGGCCACAGCTGGGCCATGG - Intergenic
1032337767 7:131042386-131042408 CCCCCCCCAGAGCTGGGCCATGG + Intergenic
1034223075 7:149460414-149460436 CCCGGCGGCGAGCTGGGCCCCGG + Intronic
1034243247 7:149625092-149625114 CCCCTCGCCCAGCTGGGCCCCGG + Intergenic
1035450271 7:158973466-158973488 TCGCGAGGACACCTGGGCCACGG - Intergenic
1035654242 8:1293418-1293440 GCTCCCGGACAGCTGAGCCATGG + Intergenic
1035689211 8:1548822-1548844 CCCCGCCGACAGCTGCCCCGGGG + Exonic
1037927065 8:22851928-22851950 CCCAGCGCCCAGCTGAGCCACGG + Intronic
1037986906 8:23295828-23295850 CCACGGGCACAGCTGGGCCGAGG + Intronic
1041257754 8:55993921-55993943 CCCTGGGGACAGCTGAGCCTTGG + Intronic
1042246321 8:66712521-66712543 CCCCGCGAAAGGCCGGGCCACGG - Intronic
1044861813 8:96531069-96531091 GCCCCAGGACAGCTGCGCCAAGG - Intronic
1044873876 8:96645428-96645450 GCCCGCGGGCGGCTGGGCCGAGG + Intronic
1048282290 8:133114347-133114369 CCCTGGGGACAGCAGGGCCTGGG - Intronic
1049450722 8:142660071-142660093 CCCTGCGGACAGCCAGGCCTGGG + Intronic
1049480406 8:142819857-142819879 CCACACGGGCAGCTGGACCATGG + Intergenic
1049615708 8:143575034-143575056 GCTCAGGGACAGCTGGGCCAAGG + Exonic
1050100975 9:2119409-2119431 ACCAGTGGACAGCTGGGGCAAGG - Intronic
1053022029 9:34701612-34701634 CCCCAGGGACGGCGGGGCCAGGG - Intergenic
1053297025 9:36922488-36922510 ACCCCAGCACAGCTGGGCCAGGG + Intronic
1055933525 9:81583964-81583986 CCAAGCGGACAGAGGGGCCATGG - Exonic
1057652750 9:96932217-96932239 CCCCAGGGAACGCTGGGCCATGG + Exonic
1059234601 9:112751018-112751040 CCCCGTGGACGGCAGGGCCTTGG - Exonic
1061497979 9:130986506-130986528 CCTCGGGGCAAGCTGGGCCATGG + Intergenic
1061593912 9:131616386-131616408 CCCCGAGCAAAGCAGGGCCACGG - Intronic
1061621545 9:131814247-131814269 CCCTGCGGGCAGGTCGGCCAGGG - Intergenic
1062060588 9:134493283-134493305 CCGCCAGGACTGCTGGGCCAGGG - Intergenic
1062249608 9:135587630-135587652 CACTGTGGACAGCTGGGGCAGGG - Intergenic
1062266606 9:135689447-135689469 CCCGGCTGCCAGCTGGGCCAGGG + Intergenic
1062601407 9:137320175-137320197 CCCCACGGACTGCCCGGCCAGGG - Intronic
1062614614 9:137390776-137390798 CCCCACTGCCAGCTGGGCCTGGG + Intronic
1186747387 X:12583731-12583753 ACCTGCAGACAGCTGGGCCCGGG - Intronic
1187443971 X:19344331-19344353 CCTGGCGCACAGCTGGGCCCGGG - Intronic
1189129012 X:38479200-38479222 ACCCGCGGTGAGCTTGGCCAGGG - Intronic
1190017119 X:46836723-46836745 CCCCGCCCACAGCTGTGGCACGG - Intergenic
1191184314 X:57592820-57592842 CCCCGCGGACCGCTGGGCTCCGG + Exonic
1191213077 X:57909639-57909661 CCCCGCGGACTGCTGGGCTCTGG - Exonic
1193165600 X:78276952-78276974 CCCCAAGGACATTTGGGCCATGG + Intronic
1197648392 X:129041037-129041059 CCCTGAGGCCAGCTGTGCCAAGG + Intergenic
1199767054 X:150948914-150948936 GCCCACGGACTCCTGGGCCAGGG + Intergenic
1199982874 X:152930499-152930521 TCCTGGGGACAGCTGGGCGAGGG + Intronic
1200091575 X:153638532-153638554 CCCCACAGACATCTGAGCCAGGG + Intergenic
1200093692 X:153647536-153647558 CCCCAGGGCCAGGTGGGCCAGGG - Intronic
1200155366 X:153972117-153972139 GCCCGCGGACGGCCGGGCGAGGG - Intergenic
1200226579 X:154420851-154420873 CCCCTCGGGAAGCTTGGCCAAGG - Intronic