ID: 1157842258

View in Genome Browser
Species Human (GRCh38)
Location 18:50969159-50969181
Sequence GGATACTGATTTGGACAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157842258_1157842261 3 Left 1157842258 18:50969159-50969181 CCAGTTTGTCCAAATCAGTATCC 0: 1
1: 0
2: 1
3: 15
4: 136
Right 1157842261 18:50969185-50969207 CAATCTACACACGTTATATTTGG 0: 1
1: 0
2: 0
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157842258 Original CRISPR GGATACTGATTTGGACAAAC TGG (reversed) Intronic
904801013 1:33093011-33093033 GGAGACTGATTTGGAGGGACTGG + Intronic
906757981 1:48339169-48339191 GGTTAATAATTTGGAAAAACTGG + Intronic
907021120 1:51067626-51067648 GGATAGTGATATGGACAATAAGG - Intergenic
907806429 1:57824968-57824990 GGATATTGATCAGGATAAACTGG + Intronic
907836433 1:58113325-58113347 GGATTCTGGTTTGGGCAACCTGG + Intronic
908103117 1:60811681-60811703 GGCTACTGATTTGCCCAAGCTGG + Intergenic
911136690 1:94448070-94448092 GAATGCTGAGTTGGAAAAACTGG - Intronic
916318537 1:163477788-163477810 GGAAACTGATTTGGAAAATGGGG - Intergenic
921900947 1:220450259-220450281 GGATACTGTTTAGGAAAATCAGG - Intergenic
922902055 1:229144838-229144860 GGACACTGATGTTGACAGACTGG - Intergenic
923284327 1:232477476-232477498 GGATACTGTTCTGGGCACACAGG + Intronic
923704905 1:236336262-236336284 GGTTGGTGATGTGGACAAACTGG - Intergenic
924767082 1:247043767-247043789 GCCTACTGATTTGCAGAAACTGG + Intronic
1062803366 10:396354-396376 GGAAAATGATTTGGATAAAGGGG - Intronic
1063891824 10:10638052-10638074 GGATACTGATGTGGACAGAGTGG + Intergenic
1068301304 10:55144512-55144534 GGAAATTGACTTGGACAAAGAGG + Intronic
1069809566 10:71148427-71148449 GAATACTGATGTGAGCAAACGGG + Intergenic
1072233814 10:93436250-93436272 GGATACTGATTGGGTCAGAATGG - Intronic
1072704543 10:97671218-97671240 TGATACTAATTTTGACAAAGAGG + Intronic
1074634702 10:115301851-115301873 GCATTTTGATTTGGACTAACTGG - Exonic
1075141454 10:119840559-119840581 GGATACCAAATTGGACAAATTGG + Intronic
1075535479 10:123268657-123268679 TGATAATGCTGTGGACAAACAGG - Intergenic
1076095141 10:127727708-127727730 GGATTCTGATTTGGAAAAAAAGG + Intergenic
1076337853 10:129720533-129720555 GGATACAGTTATGGACAAAATGG + Intronic
1078878690 11:15425625-15425647 GGATAATGATTGGGACAAAAGGG - Intergenic
1079115352 11:17637319-17637341 GGATCCTGGATTGGACAAACAGG - Intronic
1080707441 11:34710067-34710089 GGATACTGCTTTGGCCCCACAGG - Intergenic
1086995243 11:93348748-93348770 AGTTACTGTTCTGGACAAACTGG - Intronic
1091068943 11:132544786-132544808 GGATACTGATTTATACAAGTGGG - Intronic
1091180197 11:133597176-133597198 GAATACAGATTTGGAGAAAGGGG + Intergenic
1091198985 11:133757184-133757206 GGTTTGTGATTTGGACCAACTGG + Intergenic
1094017024 12:25875727-25875749 AGAAACTGATTTGGATAGACAGG + Intergenic
1094678035 12:32640462-32640484 GGATGCTCATTTGGACCACCTGG - Exonic
1095154738 12:38838860-38838882 GGAAACAGATTTGGAAAATCTGG - Intronic
1097086217 12:56470237-56470259 GGATAATGATTATGACAGACTGG - Exonic
1097182075 12:57177426-57177448 GGATCCTGTTTTGGACAGACTGG + Exonic
1098055833 12:66504062-66504084 GGGAAATGATTTGGACAAACTGG + Intronic
1100454279 12:94736900-94736922 GAATAGTGGTTTAGACAAACAGG - Intergenic
1104177559 12:126347850-126347872 GGATAATGATTTCGACACCCTGG - Intergenic
1105920575 13:24959536-24959558 AGAAACTGTTTTGAACAAACAGG + Intergenic
1106729271 13:32522480-32522502 GGATGCTGGCTTTGACAAACTGG + Intronic
1111700820 13:91685351-91685373 AAATATTGATTTGGACAAACTGG - Intronic
1113180534 13:107620249-107620271 TGGTAATGATTTGGACAAAGGGG + Intronic
1120583441 14:86282151-86282173 GGAAACTGCCTTGGACAAACTGG + Intergenic
1120857735 14:89227250-89227272 AAATCCTGATTTGGACAAATGGG - Intronic
1122121332 14:99555071-99555093 GGTTACTGATGAGAACAAACAGG + Intronic
1123930286 15:25166322-25166344 GTATACTGATTTGGTCAACCTGG + Intergenic
1124052668 15:26212550-26212572 GGATCCTGATTTGGACAAAAGGG + Intergenic
1127328637 15:57918212-57918234 GGTTTCTGACTTGCACAAACTGG - Intergenic
1129746957 15:78028945-78028967 GAATCCTCATTTGAACAAACTGG + Intronic
1129790445 15:78337551-78337573 GGAGGCTGAGGTGGACAAACTGG + Intergenic
1129955242 15:79630474-79630496 GGATAATGGTTAGGACAAAAAGG + Intergenic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1143999530 17:11040040-11040062 GGATACTGTATTGGTCAAATAGG + Intergenic
1148293224 17:46475460-46475482 GGATTCTAATTTGGAAACACTGG - Intergenic
1148315409 17:46693163-46693185 GGATTCTAATTTGGAAACACTGG - Intronic
1149260619 17:54876439-54876461 TGATAGTGATATGGACAAATAGG + Intergenic
1149832678 17:59885457-59885479 GGATACTGCTTTGGTCCCACGGG - Intronic
1153169711 18:2301960-2301982 GGATACAGATATAGAGAAACTGG + Intergenic
1157842258 18:50969159-50969181 GGATACTGATTTGGACAAACTGG - Intronic
1160963449 19:1735019-1735041 GGACACAGAGTTGGCCAAACCGG + Intergenic
1165048418 19:33124859-33124881 GGATACTGATTGGATCACACAGG + Intronic
928557080 2:32438094-32438116 AAATACTGATTTTGACAAAATGG + Intronic
929528912 2:42732935-42732957 TGATAGTGATATGGACAAAAAGG - Intronic
929626775 2:43416943-43416965 GTAAACTGATTTGGAAAAAAAGG - Intronic
930835206 2:55785538-55785560 GGTTTCTGATTTGGACAACTGGG - Intergenic
931017298 2:57998035-57998057 GGATGCTGACTGGGACATACTGG + Intronic
931578953 2:63752609-63752631 GGATACTGATTTAGACATGACGG + Intronic
933214232 2:79608943-79608965 GCATACTAATTTGGAGAAAATGG + Intronic
934757941 2:96837942-96837964 GGATACTGATTGGTATAAAAAGG + Exonic
936897505 2:117445226-117445248 TGATAGTGATTTGGACAATAAGG + Intergenic
938482755 2:131675205-131675227 GGACACAGATTTGGAAAAATAGG + Intergenic
939852471 2:147318056-147318078 GGATACTGAAGTAGATAAACTGG - Intergenic
940846887 2:158651486-158651508 AGCTACTGATTTGGACAGGCAGG - Intronic
943426560 2:187744573-187744595 GGAGAATGATTTGGAGCAACTGG + Intergenic
945336698 2:208600623-208600645 TGATAGTGATATGGACAATCAGG - Intronic
945383980 2:209174853-209174875 AGATACTAATTGGGACATACTGG + Intergenic
947371338 2:229449699-229449721 AGCTGCTGATTTGGGCAAACTGG - Intronic
1170335371 20:15264856-15264878 GGATAGTGAGATGGACAGACTGG + Intronic
1170934293 20:20796421-20796443 AGAATCTGATTTGGAAAAACAGG + Intergenic
1173348889 20:42226599-42226621 GGATCCTGAGATGCACAAACTGG - Intronic
1175117386 20:56692182-56692204 GGACACTGATTTGTACAATTAGG + Intergenic
1179008143 21:37532313-37532335 GAATCCTGGTTTGAACAAACTGG - Intergenic
1183120645 22:35727672-35727694 GGATACTGGTATGGACAAGAGGG - Intronic
956553092 3:70484157-70484179 GCAAACAGATTTGGACCAACTGG + Intergenic
958763596 3:98338650-98338672 TGATACTAATGTGGAGAAACTGG + Intergenic
961750622 3:129092154-129092176 GGATCCTGATCTCAACAAACTGG + Intronic
961971042 3:130968566-130968588 GGCTAATGAGTTGGCCAAACTGG + Intronic
964378389 3:156072249-156072271 TGATACGGATTGTGACAAACGGG + Intronic
964814606 3:160703478-160703500 CTATACTGATTTAGAGAAACAGG - Intergenic
966811642 3:183851482-183851504 GGAAAAAGATTTGGAGAAACAGG + Intronic
968012985 3:195299267-195299289 GGTTACGGATTTGGAAAAACTGG + Intronic
970577807 4:17444910-17444932 TGATAGTGATATGGACAATCAGG - Intergenic
972173094 4:36371130-36371152 GGAAGCTCATTTTGACAAACTGG + Intergenic
972675920 4:41258896-41258918 GGAGACTGATTTGGTCAACCAGG - Intronic
972966084 4:44511952-44511974 GGTTACTAATTTTGACAGACTGG + Intergenic
974110386 4:57518954-57518976 TGATACTGAATGGGAAAAACTGG + Intergenic
981287542 4:143036728-143036750 GGATAAATATTTGGACAAAAAGG + Intergenic
982159996 4:152558763-152558785 AGATACTGATTTGAAAATACTGG - Intergenic
982359803 4:154507224-154507246 TGATACTGCTTTGCAAAAACAGG + Intergenic
982897951 4:160957854-160957876 GGAAACAGATTTGGACAGATGGG + Intergenic
987071804 5:14344300-14344322 GCATACTGATTTTAAAAAACAGG + Intronic
992037251 5:72792323-72792345 GGAAACTGCTTAGGGCAAACCGG - Intergenic
993989919 5:94643394-94643416 AGATACTGAATTGGATAAAATGG - Exonic
994388461 5:99160897-99160919 GCAAACTCATTTGGACAAAATGG + Intergenic
994552709 5:101258078-101258100 TGATAGTGATTTGGACAAGAAGG + Intergenic
994813171 5:104548693-104548715 GGATACTGATTCAGGCAAACAGG + Intergenic
998097490 5:139404460-139404482 GGATAAAGATTTGGAGAAAGAGG - Intergenic
998360905 5:141585850-141585872 GAATTGTGATTTGAACAAACTGG + Intronic
1002595505 5:180319335-180319357 GGATCCTGATTTGAAGAAACCGG - Intronic
1003222423 6:4172945-4172967 GGATAATGAATTGGCCAAAGAGG - Intergenic
1005153134 6:22775575-22775597 GGATAGTGGTGTGGATAAACAGG - Intergenic
1007450646 6:41938850-41938872 GCACACGGATTTGGACCAACTGG + Intronic
1009480848 6:64156617-64156639 TGATAGTGATATGGACAAAAAGG + Intronic
1010466585 6:76174164-76174186 GGATATTGATTTGGAAATATGGG + Intergenic
1010810507 6:80293953-80293975 GGATAGTGATATGGACAATAAGG - Intronic
1015104464 6:129519968-129519990 GGACACTGAGTGGGATAAACAGG + Intergenic
1022033193 7:26510997-26511019 TGATACACATTTGGGCAAACTGG - Intergenic
1022211829 7:28218329-28218351 AGATACTCATTTTGAGAAACAGG - Intergenic
1022977501 7:35572701-35572723 GGATGCTGGTTTGTACAGACAGG + Intergenic
1024986896 7:55202016-55202038 AGGTCCTGATTTGGTCAAACTGG - Intronic
1026118002 7:67512432-67512454 GGATACTGATTGTGACAAATTGG + Intergenic
1027481303 7:78700607-78700629 GTATACTGATTTGTTCAAAGTGG - Intronic
1030458968 7:109807427-109807449 TGATACTGATATGGACAATAAGG + Intergenic
1032896924 7:136261583-136261605 GGGTACTGATATTGAAAAACAGG + Intergenic
1033747988 7:144336732-144336754 GGATACTGCTATGGACAATAAGG - Intergenic
1036945192 8:13088521-13088543 CCATACTGTTTTGGACATACTGG + Exonic
1038146873 8:24905335-24905357 GGATAGTGATCTGGTCAGACTGG - Intergenic
1038403130 8:27300581-27300603 GGCTACTGAGTGGGACAAATGGG - Intronic
1042650834 8:71039106-71039128 GGATGCTGATTTTAACAATCAGG + Intergenic
1043274670 8:78378122-78378144 GGATACTCATTTGAAGAAAAAGG - Intergenic
1043583948 8:81745925-81745947 TGTTACTGATTTGGCCAAAAAGG - Intronic
1043781263 8:84338885-84338907 GGTTACTGATTTTGACATATTGG - Intronic
1046165820 8:110433445-110433467 AGATACTGTTTTGGATAAAAGGG - Intergenic
1046366322 8:113237117-113237139 AGGTAATGATTTGGACAAAAGGG - Intronic
1048364701 8:133728639-133728661 GGATACTGCATTGGACACACAGG + Intergenic
1048814305 8:138317438-138317460 GGATATTGATATGGACAGTCAGG - Intronic
1049944127 9:578091-578113 GGATACTGAACTGGCCATACTGG + Intronic
1050498812 9:6272527-6272549 AGATACTGTTTAGGCCAAACTGG - Intergenic
1051351760 9:16204324-16204346 GGATAAGGATTTGGACACAGGGG - Intronic
1051696614 9:19774663-19774685 GGACACTGAGTTAGACAAGCAGG - Intronic
1052056994 9:23917646-23917668 GGATAATGAAGTGGATAAACTGG + Intergenic
1058377960 9:104346485-104346507 AGATACTGATTTGGGCAGAGTGG + Intergenic
1185629688 X:1507099-1507121 GGACTCCGATTTGAACAAACAGG - Intronic
1192005604 X:67208766-67208788 GGTTACTGATATGGACAATGAGG - Intergenic
1193681243 X:84521169-84521191 TGATACTGATTAAGACAAAATGG + Intergenic
1198127921 X:133665116-133665138 GTATACTGATTTTCACACACTGG + Intronic
1198139147 X:133785275-133785297 GTATACTGCTTTTCACAAACAGG - Intronic
1198238153 X:134756469-134756491 GGATAGCCATTTGGACAAAAAGG - Intronic
1198798527 X:140425624-140425646 GGTTACTGCTATGGACAAATGGG + Intergenic
1200740152 Y:6845836-6845858 GGAGAATGAGTTTGACAAACTGG - Intergenic
1201956225 Y:19626237-19626259 TCATACTGAATTGGAAAAACTGG - Intergenic
1202032399 Y:20591468-20591490 GGAAACTGCTTAAGACAAACCGG - Intronic