ID: 1157843225

View in Genome Browser
Species Human (GRCh38)
Location 18:50978561-50978583
Sequence CCGGGTCCCTCCCATGATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 3, 1: 15, 2: 40, 3: 107, 4: 236}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157843219_1157843225 -2 Left 1157843219 18:50978540-50978562 CCATGATTCAATTACTTCCCACC 0: 128
1: 2057
2: 5550
3: 9521
4: 10896
Right 1157843225 18:50978561-50978583 CCGGGTCCCTCCCATGATGTAGG 0: 3
1: 15
2: 40
3: 107
4: 236
1157843217_1157843225 5 Left 1157843217 18:50978533-50978555 CCTGCTCCCATGATTCAATTACT 0: 8
1: 219
2: 1717
3: 2752
4: 2959
Right 1157843225 18:50978561-50978583 CCGGGTCCCTCCCATGATGTAGG 0: 3
1: 15
2: 40
3: 107
4: 236
1157843218_1157843225 -1 Left 1157843218 18:50978539-50978561 CCCATGATTCAATTACTTCCCAC 0: 219
1: 3396
2: 6692
3: 9469
4: 10482
Right 1157843225 18:50978561-50978583 CCGGGTCCCTCCCATGATGTAGG 0: 3
1: 15
2: 40
3: 107
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157843225 Original CRISPR CCGGGTCCCTCCCATGATGT AGG Intronic
900127093 1:1073503-1073525 CAGGGTCCCTGCCATGAAGTGGG - Intronic
901225208 1:7609260-7609282 CCGGGCACCTGCCATGCTGTGGG - Intronic
901376003 1:8840045-8840067 CCAGGTCCCTCCCACGACATAGG - Intergenic
901630776 1:10647141-10647163 CTGGGCCCCTTCCATGCTGTGGG + Intronic
902066194 1:13690166-13690188 CAGGTTCCCTCCCATAACGTGGG + Intergenic
902674184 1:17997046-17997068 CCAGGTCTCTCCCATGACATGGG + Intergenic
902890246 1:19438083-19438105 CCGGTCCCCTCCCCTGACGTAGG - Intronic
904893113 1:33794131-33794153 CAGGGTCCCTGGCAGGATGTGGG - Intronic
905095137 1:35463796-35463818 CCAGGTTCCTCCCATGAGGTGGG - Intronic
908068760 1:60435379-60435401 CTGGGTCCCTCCCATGATGTGGG + Intergenic
908889881 1:68834165-68834187 CCAGGTCTCTCCCTTGACGTGGG + Intergenic
909228896 1:73060845-73060867 CCAGGTCCCTCCCACGACATGGG - Intergenic
909376627 1:74949223-74949245 CTGGGTCCCTCCTATGACATGGG - Intergenic
910538210 1:88324051-88324073 CCAGGTCCCTCCCATGATGGTGG + Intergenic
911880937 1:103237199-103237221 CGGGGTCCCTCCCATAACGTGGG - Intergenic
913239674 1:116819268-116819290 CTGGGTTTTTCCCATGATGTTGG + Intergenic
913668262 1:121070513-121070535 CTGGGTCCCTCTCATTATGTGGG + Intergenic
913710144 1:121474473-121474495 CTGGGTCCCTCCCATGATGTGGG + Intergenic
914020006 1:143857954-143857976 CTGGGTCCCTCTCATTATGTGGG + Intergenic
914658504 1:149765868-149765890 CTGGGTCCCTCTCATTATGTGGG + Intergenic
914988292 1:152478161-152478183 CCAGGTCCCTCCAATGACATGGG + Intergenic
916384953 1:164256421-164256443 CCAGGTCCCTCCCTCAATGTTGG - Intergenic
918352303 1:183669964-183669986 CCGGGTCCCTCTTATGACGTAGG + Intronic
918459690 1:184763867-184763889 CTGGGTCCCTCCCACGACATGGG + Intergenic
919522035 1:198600546-198600568 CCAGGTCCCTCCCCCAATGTCGG - Intergenic
920961541 1:210668375-210668397 CCGGGTCCTTCCCATGACCATGG - Intronic
921272289 1:213483274-213483296 CTGGGTCCCTCCCATGACGTGGG + Intergenic
921531093 1:216284263-216284285 CCTGGTTCCTCCCATGACATGGG - Intronic
922188481 1:223296674-223296696 CCTGGTCCCTGCCATGACATGGG - Intronic
923179318 1:231500532-231500554 CCAGGTCCCTCCCACGACATAGG + Intergenic
923932675 1:238720732-238720754 CCAGGTCCCTCCCATAACATTGG + Intergenic
924394881 1:243607787-243607809 CCAGGGCCCTCCCATGACATGGG - Intronic
1065707539 10:28484514-28484536 CCAGGTCCCTCCCATGACACTGG + Intergenic
1069173765 10:65263909-65263931 CCAGGTTCCTCCCATGATGTGGG + Intergenic
1071159148 10:82726371-82726393 CTGGGTCCCTCCCATGACATGGG - Intronic
1071597063 10:86936069-86936091 CCTGATCTCTCCCTTGATGTGGG + Exonic
1072259896 10:93659726-93659748 CTGGGTCACTCCCATGAATTGGG + Intronic
1073898537 10:108191603-108191625 CTGGGTTCCTCCCACAATGTGGG - Intergenic
1074622485 10:115139614-115139636 CTGGGTCCCTTCCATAACGTGGG + Intronic
1075199467 10:120390136-120390158 CTGGGTCCCTCCCATGACACAGG + Intergenic
1076448122 10:130532619-130532641 CCAGGTCCCTCCCCTGACATTGG + Intergenic
1076931167 10:133532873-133532895 GCTCGGCCCTCCCATGATGTGGG + Intronic
1077193264 11:1264996-1265018 CTGGGTCCCTCCCACAACGTGGG + Intergenic
1077667917 11:4131303-4131325 CCAGGTCCCTCCCGTAACGTGGG + Intronic
1078418773 11:11189389-11189411 CCAGGCCCCTCCTCTGATGTGGG + Intergenic
1078519410 11:12051228-12051250 CTGGGTTCCCACCATGATGTGGG - Intergenic
1078857383 11:15217324-15217346 CCAGGTCCCTCTCATGACATGGG + Intronic
1079519551 11:21309864-21309886 CTGGGTTCCTCCCATGATGTGGG + Intronic
1079656256 11:22989309-22989331 CCAAGTTCATCCCATGATGTGGG + Intergenic
1080467265 11:32509382-32509404 CAGGGTCCCTTCCATGTTGCAGG - Intergenic
1080740061 11:35055640-35055662 CCGGGTCCCTTCCATGAAGGGGG - Intergenic
1080850283 11:36062592-36062614 CCAGGTCCCTCCCATGACGTGGG - Intronic
1082742240 11:56923840-56923862 CCAGGTCCCTCCCTTGACATGGG + Intergenic
1084360252 11:68664539-68664561 CCTGGTCACTCCTATGATGGTGG + Intergenic
1085811200 11:79682934-79682956 CCAGGTCCCTCCCTTGACATGGG - Intergenic
1086276717 11:85138602-85138624 GTGGGTCCCTCCCACGACGTGGG - Intronic
1088117919 11:106333584-106333606 CCAGGTCCCTCCCCTGACATTGG + Intergenic
1088736088 11:112728878-112728900 CCGGCTCACTCACATGATCTGGG - Intergenic
1089512221 11:119006770-119006792 CTGGGTCCCTCCCACAACGTGGG - Intronic
1090583496 11:128185125-128185147 CTGGGTCCCTCCCATGACGTGGG - Intergenic
1093690784 12:22106240-22106262 CTGGGTCCCTCCCATGACACTGG + Intronic
1094246003 12:28294336-28294358 CCAGGTCCCTCCCTTGACATGGG - Intronic
1094266557 12:28566381-28566403 CCGGGTCCCTCCCATGATGTGGG + Intronic
1094767696 12:33617264-33617286 CCAGGTCCCTCCAATGACGTGGG - Intergenic
1095350487 12:41204712-41204734 CCTGGTCTCTCCCTTGACGTGGG + Intronic
1095891287 12:47236561-47236583 CTGGGTCACTCCCAGGAAGTGGG - Exonic
1097315824 12:58170702-58170724 CCAGGTCCCTCCCATGATGTGGG - Intergenic
1097558305 12:61167562-61167584 CTGGGTCCCTCCTATGACATAGG + Intergenic
1097610039 12:61808128-61808150 CTGGGTCCCTCCCACAACGTGGG - Intronic
1098592456 12:72229424-72229446 CAAGGTCCCACTCATGATGTGGG + Intronic
1099544224 12:83956140-83956162 CTGGGTCCCTCCTCTGATGTTGG + Intergenic
1099676882 12:85772665-85772687 CTGGGTCACTCCCATGACGAGGG - Intergenic
1100584503 12:95967265-95967287 CTGGGTCCCTCCCACAATGTGGG + Intronic
1100747637 12:97662870-97662892 CCAGGTCCCTCCCATGACGTGGG + Intergenic
1100933748 12:99639555-99639577 CTGGGTCCCTCCCATGACGTGGG - Intronic
1101032726 12:100676265-100676287 CTGGGTCCCTCCCATAAAGTGGG - Intergenic
1101231669 12:102747742-102747764 CTGGGTCCCTCCCATGACATGGG + Intergenic
1101336215 12:103799325-103799347 CCAGGTCCCTCCCACAATCTGGG - Intronic
1101395340 12:104342172-104342194 CCTGCTCCCTCCCCAGATGTAGG + Intronic
1101684344 12:107002731-107002753 CAGGGTCCCTCCCATGATGTGGG - Intronic
1102395393 12:112581399-112581421 CTGGGTCCCTCCCATGACATGGG + Intronic
1103002923 12:117399421-117399443 CCAGGTCCCTCCCACAACGTGGG + Intronic
1105462911 13:20608418-20608440 CCGGGTCCCTGCCGAGATCTTGG + Intronic
1107515627 13:41125978-41126000 CCGGGTCCCTCCCATGATGTGGG - Intergenic
1108259920 13:48646212-48646234 CCTGGTCTCTCCCTTGACGTGGG - Intergenic
1108686626 13:52825815-52825837 CTGGGTCCCTCCCATGACAGTGG - Intergenic
1109416711 13:62050546-62050568 CCAGATCCCTCCTATGACGTGGG - Intergenic
1109681999 13:65763734-65763756 CCAGGTCCCTTCCTTGACGTGGG + Intergenic
1109697458 13:65978671-65978693 CTGGGTCCCTCCCATGACATGGG - Intergenic
1111010032 13:82300811-82300833 TTGGGTTCCTCCCTTGATGTGGG - Intergenic
1111172308 13:84543298-84543320 CCGGGTCCCTCCCATGACATGGG + Intergenic
1111285667 13:86089041-86089063 CTGGATCCCTCCCATGACGTGGG + Intergenic
1111510681 13:89258015-89258037 CCAGGTCCCTCCCATGACGTGGG - Intergenic
1111649709 13:91073752-91073774 ATGGGTCCCTCCCATGACGTGGG + Intergenic
1111791234 13:92858173-92858195 CCAGGTCCCTCCCATGACACAGG - Intronic
1111943280 13:94636364-94636386 CTGGGTCCCTCCCACAACGTGGG + Intergenic
1112073649 13:95883488-95883510 CCAGGCCCCTCCCCTGACGTGGG - Intronic
1114707173 14:24738802-24738824 CCTGGTCCCTCCCACAATGCTGG + Intergenic
1114909499 14:27172323-27172345 CAGGGATCCTCCCATGACGTGGG + Intergenic
1114948262 14:27714817-27714839 CGGGGTCCTTCCCATAACGTGGG - Intergenic
1115055780 14:29124671-29124693 CTGGGTTTCTCCCATGATGTGGG + Intergenic
1115744931 14:36427059-36427081 CCAGGCCTCTCCCTTGATGTAGG + Intergenic
1116316545 14:43402793-43402815 CGAGGTTCCTCCCATGACGTGGG + Intergenic
1117854054 14:60009497-60009519 CTGGGTCCCTCCCATGACGTGGG + Intronic
1117880249 14:60306264-60306286 CCTGGTCCCTCCCATAACGTGGG + Intergenic
1118970226 14:70630206-70630228 CAGGGACCCTTCCATGATATAGG + Intergenic
1119035829 14:71230054-71230076 CCGGGTCCCTCCCACGATGTGGG + Intergenic
1119200676 14:72749625-72749647 CCGGGTCCTTCCCACAACGTGGG - Intronic
1120126086 14:80745076-80745098 CTGGGTCCCTCCCACAACGTTGG - Intronic
1120132695 14:80825159-80825181 CCGGGTCCCTCCCACAACGGTGG + Intronic
1120661510 14:87256654-87256676 CCAGGTCCCTCCCTTGACATGGG - Intergenic
1120696107 14:87647482-87647504 CCGGGTCCCTCCCATGACGTGGG + Intergenic
1120724403 14:87921856-87921878 CTGGATCCCTCCCACGATGTGGG - Intronic
1120785268 14:88528561-88528583 CCAGGTCCCTCCCACAACGTGGG - Intronic
1121318436 14:92975846-92975868 CCGGCTCCCTCCCATGACATGGG - Intronic
1121969891 14:98346247-98346269 CCGGGTTCCTCCCATGACACAGG + Intergenic
1122177235 14:99929979-99930001 CCTGGGCCTTCCCAGGATGTGGG + Intronic
1122935777 14:104955422-104955444 CCAGGTCCCTCCCATCCTGGTGG + Intronic
1122948176 14:105023361-105023383 CCGGGTCCCTCCCACGACATGGG + Intergenic
1125206685 15:37161434-37161456 CCAGGTCCCTCCCTTGACATGGG - Intergenic
1125471969 15:40013702-40013724 CTGGGTCCCTCCCATGACACAGG + Intronic
1126246482 15:46512062-46512084 CCAGGTCTCTCCCTTGATGTGGG - Intergenic
1126436581 15:48644574-48644596 CCGGTTCCCTCCTTTGGTGTGGG - Intronic
1126824943 15:52539649-52539671 TGGGGTCCCTCTCATGATGTGGG + Intergenic
1127009708 15:54610013-54610035 CCAGGTCCCTCCAATGACATGGG + Intronic
1127244770 15:57160424-57160446 CCAGGTCCCTCCCACGACGTGGG + Intronic
1127286883 15:57540488-57540510 CTGGGTCCCTCCCATGACACTGG + Intronic
1127356623 15:58207061-58207083 CTGGGTCCCTTCCATAATGTGGG - Intronic
1129174776 15:73832128-73832150 CAGGGTCCCTGGCATGAGGTAGG - Intergenic
1129753024 15:78079152-78079174 CCCTGTCCCTCCCATCATCTGGG - Intronic
1131450363 15:92534503-92534525 CGGGGTCCCTCCCGTGACGTGGG - Intergenic
1131719582 15:95153220-95153242 CTGGGTCCCTCCCACAACGTGGG - Intergenic
1131956607 15:97742709-97742731 CTGGTTCCTTCCCATCATGTAGG - Intergenic
1131984021 15:98023227-98023249 CCAGGTCCCTCCCATGATGTGGG - Intergenic
1132743442 16:1427263-1427285 CCGGCTCCCACCCTTGCTGTGGG - Intergenic
1133080227 16:3312877-3312899 CTGGGTACCTCCCAGGCTGTGGG + Intronic
1133752570 16:8736224-8736246 CTGGGTCCCTCCCATGACGTGGG + Intronic
1133823038 16:9253762-9253784 CCAGGTCCCTCCCATGACATGGG + Intergenic
1134459191 16:14417050-14417072 CCGGGTCCCTCCCACAACATGGG - Intergenic
1135964067 16:27021438-27021460 CCGGGTCCCTCCCACAACATGGG - Intergenic
1136043652 16:27599504-27599526 CCCCGTCCCTCCAATGATGCAGG + Intronic
1138770828 16:59661436-59661458 CCTGGTCCCTCCCGTGACATGGG + Intergenic
1139032338 16:62900298-62900320 CCAGGTCTCTCCCATAATTTTGG - Intergenic
1140848315 16:78910815-78910837 CCGGGTCCCTCCCATGACGTGGG + Intronic
1141345195 16:83238446-83238468 CCAGGTCACTCCCATGACATGGG + Intronic
1141950930 16:87338861-87338883 TGGGGTCCCTCCCATGACATGGG - Intronic
1147348570 17:39822304-39822326 CTGGGTCCCTCCTATGACATGGG - Intronic
1148072157 17:44914859-44914881 TCTGGTCCCTCCCATCATGTTGG + Intronic
1149234282 17:54571912-54571934 CTGGGTCCCTCCCACAACGTGGG + Intergenic
1149303736 17:55328849-55328871 CCAGGTCCCTCCCATGACACAGG + Intergenic
1149902179 17:60490685-60490707 CCAGGTCCCTCCCATAATGTGGG - Intronic
1150291078 17:63982653-63982675 CTGGGTCCCTCCTAACATGTGGG - Intergenic
1151211534 17:72548073-72548095 CTGGGTCCCTCCCACAATGCGGG + Intergenic
1153348235 18:4051546-4051568 CTGGGTCCCTCCCACAATGTGGG + Intronic
1156953456 18:42933465-42933487 CCAGGTCCCTTCCAGGATGTGGG - Intronic
1157454262 18:47812134-47812156 CTGGGTCCCTCACATAATATGGG - Exonic
1157843225 18:50978561-50978583 CCGGGTCCCTCCCATGATGTAGG + Intronic
1158061638 18:53349810-53349832 CCAGGTTCCTCCCATGACGTGGG + Intronic
1158108841 18:53917293-53917315 CTGGGTCTCTCCCATGACGTGGG - Intergenic
1158218628 18:55127170-55127192 CTGGGTCCCTCCCATGACACAGG - Intergenic
1158879924 18:61768347-61768369 CTGGGTCCCTCCCAGGAACTTGG - Intergenic
1158905452 18:62006941-62006963 CCGGGTCCCTCCCACAACATGGG + Intergenic
1159138295 18:64362396-64362418 CTCGGTCACTCCCATGATGTGGG + Intergenic
1159650276 18:70970394-70970416 CCGGGTCCATCCCATAACATGGG + Intergenic
1160547595 18:79670711-79670733 CCGGGTCCCTCCCATGACGTGGG - Intergenic
1168585338 19:57587174-57587196 CCAGGTCCCTCCCATGACATGGG + Intronic
925117852 2:1395660-1395682 CCAGGTCCCTCCCTTGACATGGG - Intronic
925151825 2:1620184-1620206 CCAGGTGCCTCCCTTGCTGTTGG + Intergenic
925299591 2:2801125-2801147 CTGGGTCCCTCTCATGACGTGGG - Intergenic
925476511 2:4222595-4222617 CAGGGTCCCTCCCATGGGGAGGG + Intergenic
926882726 2:17565808-17565830 CCTGGTCCCTCCCATGACGTGGG - Intronic
930507593 2:52304194-52304216 CTAGGTCCCTCCCATGACATGGG - Intergenic
930942256 2:57026950-57026972 CTGGGTCCCTCCCATGACGTGGG + Intergenic
933454464 2:82503035-82503057 CCGGGTTCCTCCCATGGCATGGG - Intergenic
935163251 2:100547636-100547658 CCGGCCTCCTCCCATGATTTTGG - Intergenic
937142293 2:119612540-119612562 CCTGGTCACTCCCATGACATGGG + Intronic
937761178 2:125604893-125604915 ACGTGTCTCTCCCATGACGTGGG - Intergenic
937961757 2:127465407-127465429 CTGGGTTCCTCCCATGACGTGGG - Intronic
939508154 2:143074649-143074671 TCTGGTCCCTCCCATGACGTGGG - Intergenic
940221484 2:151356533-151356555 CTTAGTCCCTCCAATGATGTTGG - Intergenic
940355836 2:152739999-152740021 CCAGGTCCCTCCCATGACGTGGG + Intronic
940686381 2:156856506-156856528 CTGGGTCCCTCCCTAGATGGAGG + Intergenic
940939802 2:159546197-159546219 CTGGGTTCCTCCCATGACGTGGG - Intronic
942387677 2:175459658-175459680 CTGGGTCCCTCCCAAAACGTGGG - Intergenic
945021175 2:205573145-205573167 CCGGTTCCCTACCATGACGTGGG + Intronic
945704054 2:213207146-213207168 CCTGATCCCTCCCAAGACGTGGG - Intergenic
948450440 2:238067025-238067047 CCGGGTCCCTCTGATGACGTGGG + Intronic
1169061028 20:2660444-2660466 CCATGCCCCTCACATGATGTTGG + Exonic
1169462620 20:5809443-5809465 CCGGCTGCCTCCCCTGAAGTGGG + Intronic
1169522287 20:6386764-6386786 CCGGGTCCCTCCCATAAAACAGG - Intergenic
1169913519 20:10666369-10666391 CCTGGTCCCTGCTTTGATGTGGG - Intronic
1170092718 20:12608872-12608894 CCAGCTCCCTCCCATTAGGTGGG + Intergenic
1170438974 20:16358595-16358617 TTGGGTCCCTCCCATGTAGTTGG - Intronic
1170470366 20:16662586-16662608 CAGGGTCACCCCCATCATGTTGG + Intergenic
1171534154 20:25871547-25871569 CTGGGTCCCTCCCATAACGTGGG - Intergenic
1173946691 20:46956997-46957019 CTGGGTCCCTCCCATGATATGGG + Intronic
1174251192 20:49220730-49220752 CCCGGTCACACCCATGATGCGGG + Intronic
1174581080 20:51572263-51572285 CTGGATCCCTCCCATGACGTGGG + Intergenic
1174766184 20:53255900-53255922 CAGGGTCCCCCCCATGAAGCTGG + Exonic
1175052766 20:56170190-56170212 CCAGGTCCCTCCCATGACATGGG - Intergenic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1177258110 21:18692379-18692401 ACGGGTCCCTCCCACCATGTGGG + Intergenic
1177487374 21:21777245-21777267 CTGAGTCCCACCCATGACGTGGG + Intergenic
1178390061 21:32190952-32190974 CCGTGTGCCTCACAGGATGTGGG - Intergenic
1178454341 21:32733448-32733470 CCTGGTCCCGCCCTTGATGTGGG - Intergenic
1178471284 21:32895188-32895210 CTGGGTCCCTCCCATGAAATGGG + Intergenic
1178782733 21:35620800-35620822 CTGGGTCCCTCCCATGACGTGGG - Intronic
1178884375 21:36473762-36473784 CCTCATCCCTCCCCTGATGTTGG - Intronic
1179527769 21:41994817-41994839 CTGGGTCCCTCCCACGACGTGGG - Intronic
1179776225 21:43664934-43664956 CTGGGTCCCTCCCACCACGTGGG + Intronic
1179794007 21:43771891-43771913 CCAGGTCCCTCCCATGACACGGG + Intergenic
1180189694 21:46156786-46156808 CCGGGTCCCTCCCATGACGTGGG - Intergenic
1183114457 22:35679612-35679634 CCAGGTCCCTCCCACGACATTGG - Intergenic
1183213006 22:36462469-36462491 ACGGGCCCCTCCCATGGTGCTGG + Intergenic
1183395240 22:37567726-37567748 CCGGCTCCCTGCCATGACGCTGG - Intronic
1184439382 22:44499422-44499444 CCAGGTTCCTCCCACGATGTGGG - Intergenic
949403301 3:3688182-3688204 CTGGGTCTTTCCCCTGATGTGGG - Intergenic
950245990 3:11418992-11419014 CCAGGTCCCTCCCCTGACATGGG + Intronic
950293376 3:11805897-11805919 CCAGGTCCCTCCCACGACGTGGG - Intronic
951205073 3:19917624-19917646 CCAGGTTCCTGCCATGTTGTTGG - Intronic
952581523 3:34838831-34838853 CCAGGTCCCTCCTATGATACAGG + Intergenic
952631384 3:35472429-35472451 CCAGGTCCCTCCCAAGACGTGGG + Intergenic
952726950 3:36596601-36596623 CTGGGCCCCTCCCCTCATGTTGG + Intergenic
953494514 3:43374518-43374540 CCCGGCCCCTACCCTGATGTTGG + Intronic
957113420 3:75994382-75994404 CTGGGTCCCTCCCATGACATGGG - Intronic
957311881 3:78530731-78530753 CCGGGTCCCTCCCACAATATGGG + Intergenic
957387097 3:79510182-79510204 TCCGGTGCCTCCCATGACGTGGG - Intronic
957779287 3:84797828-84797850 TTGGGTCCCTCCCATGATGTGGG - Intergenic
958090329 3:88869383-88869405 CCTGGTCCTTCCCATGACATGGG + Intergenic
958157194 3:89770631-89770653 CTGGGTCCCTCCCATGACATGGG + Intergenic
959856264 3:111162314-111162336 CCAGGTCCTTCCCATGATGTGGG - Intronic
962339643 3:134571053-134571075 CTGGGTCCCTCCCACAACGTGGG + Intronic
963345599 3:144093388-144093410 TCAGGTTCCTCCCATGACGTGGG - Intergenic
963701396 3:148630685-148630707 CTGGGTCCCTCCCTTCAGGTGGG - Intergenic
964453119 3:156831757-156831779 CCAGGTCCCCCTCACGATGTGGG + Intronic
965666315 3:171097484-171097506 CCGGGTCACTCCCATGTCGTGGG - Intronic
966415319 3:179683673-179683695 CCGGATTCCTCCCATGACATGGG + Intronic
968524930 4:1051782-1051804 TCGGGTCCCTTCCACAATGTGGG - Intergenic
970107122 4:12597002-12597024 CCGAGTCCCTCCCATGACAAAGG - Intergenic
970309468 4:14766991-14767013 CCAGGTCCCTCCCCTAATATCGG + Intergenic
970324219 4:14906462-14906484 CTGGGTCCCTCCCATAACATGGG - Intergenic
970571533 4:17388054-17388076 CCAGGTCCCTCCCATGACAGTGG + Intergenic
971278961 4:25225395-25225417 CTGGGTCCCTCCCAGGACATAGG + Intronic
971831991 4:31706165-31706187 CTGGGTTTCTCCCATAATGTGGG + Intergenic
972332430 4:38076328-38076350 CCTGGTCCCTCCCATGACATGGG + Intronic
972463752 4:39331914-39331936 CTGGATCCCTCCCATAATGTGGG - Intronic
973601700 4:52548876-52548898 CCAGGTCCCTCCCAAGACGTGGG + Intergenic
974763250 4:66306918-66306940 CTGGGCCCCTCCCATGACGTGGG - Intergenic
975036353 4:69687714-69687736 CCTGGTCCCTCCCATGACGTGGG + Intergenic
976852001 4:89558476-89558498 CCGGGTCTCTCCCATGATGTGGG + Intergenic
977870855 4:102089001-102089023 CTGGGTCCCTCCTATGACGTGGG - Intergenic
977943093 4:102879149-102879171 CCAGGTTCCTCCCTTGACGTGGG + Intronic
979310081 4:119192926-119192948 CCAGGTCCCTCCCTTGATTTGGG - Exonic
980884911 4:138752048-138752070 CTGGGTCCCTCCCATGACACTGG - Intergenic
980990599 4:139735504-139735526 CCCGGTCCCTCCCGGGCTGTCGG - Intronic
981945589 4:150339929-150339951 CGGGGTCCTTCTCACGATGTGGG - Intronic
982299738 4:153866642-153866664 CTGGGTCCCTCCCATGACATAGG - Intergenic
983713799 4:170753393-170753415 CTGGGTCCCTCGCATGATGTGGG - Intergenic
984592509 4:181632336-181632358 CCAGGTCCCTCCCCTGACATTGG + Intergenic
984720562 4:182969290-182969312 CCGGGTCCCTCCCACGACACAGG + Intergenic
986557530 5:9026339-9026361 CCTGGTCCCTCCAATGATGTGGG - Intergenic
986900051 5:12420597-12420619 CCAGGTCCCTCCCTTGACATGGG - Intergenic
987196782 5:15534922-15534944 CCAGGTCCCTCCCCTGACATGGG - Intronic
987384237 5:17313898-17313920 CCAGGTCCCTCCCATGACACAGG - Intergenic
987806761 5:22779570-22779592 CTAGGTCCCTCCCTCGATGTGGG - Intronic
987851712 5:23363142-23363164 CTGTGTCCCTCCCATGACATGGG + Intergenic
988177746 5:27748874-27748896 CTAGGTCCCTCCCATGACATGGG + Intergenic
988679917 5:33474895-33474917 CAGGGTTCCTCCCATGATGTGGG + Intergenic
990859659 5:60312672-60312694 CCTGGTCCCACCCTTGACGTGGG + Intronic
991276185 5:64849680-64849702 CCAGGTCCCTCCCTTGACATGGG - Intronic
991340487 5:65602873-65602895 CTGGGTCCCTCCCAAAACGTGGG + Intronic
991578009 5:68125062-68125084 CCAGGTCTCTCCCATGACATGGG - Intergenic
993569696 5:89522004-89522026 CCAGGTCCCTCCCATGACGTGGG + Intergenic
993671877 5:90770329-90770351 CCAGGTCCCTCCCATGACGTGGG + Intronic
994357952 5:98816210-98816232 CCAGGTCCCTCCCATGACATGGG - Intergenic
994793545 5:104263728-104263750 CCAGGTCCCTCCCATGACACAGG - Intergenic
994994988 5:107049597-107049619 CCAGGTCTCTCCCATGACGTGGG - Intergenic
995860584 5:116636411-116636433 CAGGGTTCCTCCCATGACGTGGG + Intergenic
996150831 5:120032674-120032696 CTGGGTCCTTCTCATGACGTGGG + Intergenic
996861490 5:128072051-128072073 CCGTGTCCCTCCCATAACATGGG - Intergenic
997841248 5:137242258-137242280 CCGGGTCCCTCCCATGACCTGGG - Intronic
998756467 5:145386304-145386326 CCAGGTCCCTCCCATGACACAGG + Intergenic
999436786 5:151569451-151569473 CTGGATCCCTCCCATGATACAGG + Intergenic
999513929 5:152281428-152281450 CCAGGTCCCTCCCATGACGTGGG - Intergenic
1001855153 5:175004318-175004340 CCAGGTCCCTCCCATGACACAGG - Intergenic
1002832317 6:834023-834045 CAGGTTCCCTCCCATGACGTGGG - Intergenic
1004592248 6:17063997-17064019 CTGGGGCCCTCCCAGGATCTTGG + Intergenic
1004718752 6:18245827-18245849 CTGGGTCCCTCCCACAACGTGGG - Intronic
1004875561 6:19948838-19948860 CCTGGTCCCTCCCATGACGTGGG + Intergenic
1005801009 6:29424767-29424789 CCAGGTCCCTCCCTTGACATGGG - Intronic
1006015586 6:31078312-31078334 CCTGGTCCCCTCCATGAAGTTGG + Intergenic
1006900975 6:37500896-37500918 CAGGTCCCCTTCCATGATGTGGG - Intergenic
1007920373 6:45603939-45603961 CTGGGTCCCTCCCATGAACATGG + Intronic
1009622119 6:66091057-66091079 CCTGGTCCCTCTCCTGACGTGGG - Intergenic
1010044187 6:71420889-71420911 CCAGCGCCCTCCAATGATGTCGG + Intergenic
1010810293 6:80292514-80292536 CCGGGTCCCTCCCATGACGTGGG + Intronic
1012254557 6:97016775-97016797 CCAGGTCCCTCCCAGGATTATGG - Intronic
1012690645 6:102307398-102307420 TCAGGTTCCTCCCATGACGTGGG + Intergenic
1012825134 6:104138464-104138486 CTGGGTCCCTCCCATGAACATGG + Intergenic
1013558631 6:111282879-111282901 CTGGGTCCCTCCCATGATGTGGG + Intergenic
1015476307 6:133662086-133662108 CTGGGTCCCTCCCATGACACAGG - Intergenic
1016106830 6:140173039-140173061 CCAGGTCCCTCCCATGACATGGG + Intergenic
1016805411 6:148207182-148207204 CCTGGCCCCTCCCATGCTGATGG + Intergenic
1016866921 6:148776839-148776861 GCGGGTCCCACCCATCATGACGG - Intronic
1016901053 6:149102582-149102604 CCTGGTCTCTCCCTTGATGTGGG + Intergenic
1017294640 6:152779452-152779474 CTTGGTCCCTCCCATGACATGGG - Intergenic
1017351903 6:153452543-153452565 CCAGGTCCCTCCCTCCATGTGGG - Intergenic
1019360333 7:601573-601595 CAGGGGCCCTCCTGTGATGTGGG - Intronic
1019369354 7:652898-652920 CCTCCTCCCTCCCATGGTGTTGG + Intronic
1021174841 7:17439230-17439252 CTGGGTTCCTCCCATGACATGGG + Intergenic
1022010313 7:26302860-26302882 CCGTCGCCCTCCCATCATGTTGG - Intronic
1022455575 7:30555565-30555587 CCAGGTCCCTCCCTTGACATGGG + Intergenic
1022580384 7:31547559-31547581 CCGGGTCCTTCCCTCGATATGGG + Intronic
1023300594 7:38766639-38766661 TCTGGTCACTCCCATGATGTGGG - Intronic
1023384030 7:39636954-39636976 CCAGGTCCATCCCCTGATGTGGG + Intronic
1023804809 7:43865045-43865067 CTGGGTCCCTCCCACAACGTGGG - Intergenic
1023984317 7:45086063-45086085 CCGGTCCCCTCCCAGGATGGTGG + Exonic
1024536450 7:50438659-50438681 CTGGGTGCCTCTCATGATGTTGG + Intergenic
1024685063 7:51735785-51735807 TTTGGTCCCTCCCATGACGTGGG + Intergenic
1026778920 7:73250276-73250298 CTGGGTCCCTCCCATGTGGCTGG - Intergenic
1027019781 7:74803684-74803706 CTGGGTCCCTCCCATGTGGCTGG - Intronic
1027068245 7:75142257-75142279 CTGGGTCCCTCCCATGTGGCTGG + Intronic
1027661039 7:80988424-80988446 CCAGGTCCTTCCCACGACGTGGG + Intergenic
1027673700 7:81133342-81133364 CTGGGTCCCTCCCATGACGTGGG - Intergenic
1027797907 7:82716665-82716687 CTGGGTCCCTCCCATGACATGGG + Intergenic
1027937678 7:84631219-84631241 CAGGGTCCCTCCCATAACGTGGG - Intergenic
1028189287 7:87826182-87826204 CCAGGTTCCTCCCATGACGTGGG - Intronic
1028360532 7:89961688-89961710 CCAGGTCACTCCCATGACGTGGG - Intergenic
1029217554 7:98962280-98962302 CTGGGTCCCTGCCCTGTTGTAGG + Exonic
1029814422 7:103078305-103078327 CCGGGTCCCTCCCACGATGTAGG - Intronic
1030470122 7:109952969-109952991 TCAGGTTCATCCCATGATGTGGG + Intergenic
1031445571 7:121849426-121849448 CTGGGTCCCTCCTATGATGTGGG + Intergenic
1032780639 7:135162688-135162710 CTGGGTCCCTCCCACAATGTGGG + Intronic
1032981775 7:137292345-137292367 CCAGGTCCCTCCCGTGACATGGG - Intronic
1033057848 7:138076104-138076126 CTGAGTCCCTCCCATGACATTGG + Intronic
1033905072 7:146192630-146192652 CTGGATCCCTCCCATGACGTGGG + Intronic
1033932956 7:146546877-146546899 CTGGGTCCCTCCCATGATTATGG + Intronic
1034258695 7:149740101-149740123 CTGAGTCCCTTCCATAATGTGGG + Intergenic
1035102114 7:156408297-156408319 CTGGGTCCCTCCCATGACATGGG - Intergenic
1035116571 7:156529568-156529590 CCAGGTCCCTCCCATGACATGGG + Intergenic
1035917210 8:3637777-3637799 CTGGGTCCCTCCCAAGATGTGGG - Intronic
1036723636 8:11200715-11200737 CCGGGGCCCCCCCATGATGGGGG - Exonic
1037558079 8:20045705-20045727 CCAGATCTCTCACATGATGTTGG + Intergenic
1038477447 8:27878081-27878103 CCGGCTCCACTCCATGATGTGGG + Intronic
1039107289 8:34003484-34003506 CTGGGTCCCTCCCATGATGTGGG + Intergenic
1039511594 8:38096298-38096320 CTGGGTCCCTCCCGTAACGTGGG - Intergenic
1041312037 8:56526753-56526775 CCAGGTCCCTTCCTTGATTTGGG + Intergenic
1041894585 8:62908519-62908541 CTGGGTCCCTCCCATGACGTGGG - Intronic
1042772825 8:72398106-72398128 CCGAGTCGCTCACAAGATGTGGG + Intergenic
1043077237 8:75717464-75717486 CTGAGTCCCTCCCATGACGTGGG + Intergenic
1043127471 8:76417935-76417957 CCGGGTCCCTCCCCTGAAACTGG - Intergenic
1046144567 8:110141337-110141359 CCGGGTCCCTCCCACAATACAGG - Intergenic
1046145128 8:110148408-110148430 CCGAGTCCCTCCCACAATGTGGG + Intergenic
1046150417 8:110217109-110217131 CTGGGTCCCTCCCATGACATGGG + Intergenic
1046495519 8:115009519-115009541 CCAGGTCCCTCCCATAGTGCTGG + Intergenic
1047115430 8:121836810-121836832 CTGGGTTCCTCCCAAGACGTGGG - Intergenic
1047206755 8:122808543-122808565 CCAGGTCCCTCCCGTGATGTGGG + Intronic
1048036593 8:130683040-130683062 CTGGGTCCTTTCCATGCTGTGGG + Intergenic
1048046215 8:130775651-130775673 CTGAGTTCCTCCCATGATGTGGG - Intergenic
1048790645 8:138100368-138100390 CTGGGTCTCCCCCATGATGTGGG + Intergenic
1049076155 8:140397938-140397960 CCAGGTCCCTCCTACAATGTGGG - Intronic
1049376057 8:142289739-142289761 CCGGCGGCCTCCCATGATGGAGG - Intronic
1049862756 8:144911291-144911313 CCAGGTTGCTCCCATGACGTGGG - Intergenic
1050441454 9:5668221-5668243 CCAGGTCCCTCCCATGACACAGG + Intronic
1050666467 9:7943234-7943256 CTGGGTCCCTCCCATGACGTGGG - Intergenic
1051243236 9:15082301-15082323 CTGGGTCCCTCCCATGACGTGGG + Intergenic
1051450821 9:17195027-17195049 CCGTGTCCCTCCCATAACGTGGG + Intronic
1054999527 9:71433250-71433272 CTGGGTCCCTCCCATGATATGGG - Intronic
1055311719 9:74989583-74989605 CCAGGTCCCTCCCTCCATGTGGG - Intronic
1056092367 9:83217464-83217486 CTGGGTCCCTCCCATGACGTGGG - Intergenic
1057642067 9:96834166-96834188 CCTGGTCCGTCCCATGACGTGGG - Intronic
1057877636 9:98770081-98770103 TCAGGTCCCTCCCATGATGCGGG - Intronic
1058961391 9:109995708-109995730 CCAGGTCCCTCCCATGGCGTGGG + Intronic
1062616698 9:137400168-137400190 CTGGGTCCCTCCCATAACGTGGG + Intronic
1185846966 X:3446847-3446869 CTCGGTCCCTCCCATGACGTGGG - Intergenic
1186288538 X:8071497-8071519 CCAGGTCCCTCCCTTGACGTGGG + Intergenic
1186704774 X:12129449-12129471 CCAGGTCCCTCCCATGACACAGG + Intergenic
1186895198 X:13998322-13998344 CCAGGTCCCTCCCTTGACGTGGG - Intergenic
1187721983 X:22160696-22160718 CTGGGTCTCTCCCATGACGTGGG + Intronic
1187928379 X:24271336-24271358 CCTGGTCCCTCCCATGACATAGG - Intergenic
1188115474 X:26238116-26238138 CCAGGTCCCTCCCACAATATTGG + Intergenic
1190614941 X:52220634-52220656 CCAGGTCCCTCCCATGACGTGGG + Intergenic
1192571965 X:72213431-72213453 CTGGGTCCCTCCCATTGTATGGG + Intronic
1193455637 X:81728481-81728503 CTGGGTCTCTCTCATGACGTGGG - Intergenic
1194034647 X:88855087-88855109 CCGGGTCCCTCTCATTACGTGGG - Intergenic
1194182868 X:90735136-90735158 CTGGGTCCCTCCCAGGACGTGGG - Intergenic
1194331112 X:92583579-92583601 CTGAGTCCCTCCCATAACGTGGG - Intronic
1194507190 X:94746735-94746757 CTCAGTCCCTCCCATGATGTGGG - Intergenic
1194542269 X:95189599-95189621 CCGGGTCCCTCCCATGACTGGGG + Intergenic
1194830646 X:98619255-98619277 GAGGGTCCCTCCCATGACGTGGG + Intergenic
1194952761 X:100145916-100145938 CCAGGTCCCTCCCATGACACAGG - Intergenic
1195554738 X:106209666-106209688 CTGGGTCCCTCCCATAACGTGGG + Intergenic
1196405619 X:115359638-115359660 CCAGGTCCCTCCCACGACGTGGG - Intergenic
1197534100 X:127666063-127666085 CCAGGTCCCTCCCATGACATGGG - Intergenic
1199067265 X:143434177-143434199 CTGGGTCCCTCCCATGACGTGGG - Intergenic
1199146680 X:144377214-144377236 CCAGGTCCCTCCCTTGACATAGG + Intergenic
1199400825 X:147396255-147396277 CTGGTTCCCTCCCATGACGTGGG - Intergenic
1199746599 X:150775763-150775785 CCAGCTCCCTCCCATGCTGCTGG - Intronic
1199854337 X:151747893-151747915 CAATGTCCATCCCATGATGTGGG - Intergenic
1200529487 Y:4317091-4317113 CTGGGTCCCTCCCAGGACGTGGG - Intergenic
1200639811 Y:5702643-5702665 CTGAGTCCCTCCCATAACGTGGG - Intronic