ID: 1157843383

View in Genome Browser
Species Human (GRCh38)
Location 18:50980040-50980062
Sequence TTAAATAAACAGTTGGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 347}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157843380_1157843383 -7 Left 1157843380 18:50980024-50980046 CCAGTCTATATAGGATTTAAATA 0: 1
1: 0
2: 0
3: 19
4: 250
Right 1157843383 18:50980040-50980062 TTAAATAAACAGTTGGAGTTGGG 0: 1
1: 0
2: 3
3: 26
4: 347
1157843375_1157843383 29 Left 1157843375 18:50979988-50980010 CCCAAAGTGCTAGGATTCAGGTG 0: 4
1: 62
2: 321
3: 896
4: 4283
Right 1157843383 18:50980040-50980062 TTAAATAAACAGTTGGAGTTGGG 0: 1
1: 0
2: 3
3: 26
4: 347
1157843376_1157843383 28 Left 1157843376 18:50979989-50980011 CCAAAGTGCTAGGATTCAGGTGT 0: 4
1: 63
2: 324
3: 783
4: 2131
Right 1157843383 18:50980040-50980062 TTAAATAAACAGTTGGAGTTGGG 0: 1
1: 0
2: 3
3: 26
4: 347
1157843379_1157843383 -6 Left 1157843379 18:50980023-50980045 CCCAGTCTATATAGGATTTAAAT 0: 1
1: 0
2: 1
3: 16
4: 218
Right 1157843383 18:50980040-50980062 TTAAATAAACAGTTGGAGTTGGG 0: 1
1: 0
2: 3
3: 26
4: 347
1157843377_1157843383 2 Left 1157843377 18:50980015-50980037 CCACTGTGCCCAGTCTATATAGG 0: 1
1: 1
2: 16
3: 177
4: 1299
Right 1157843383 18:50980040-50980062 TTAAATAAACAGTTGGAGTTGGG 0: 1
1: 0
2: 3
3: 26
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157843383 Original CRISPR TTAAATAAACAGTTGGAGTT GGG Intronic
901141790 1:7039197-7039219 TTTAATATACTGTTGGAGTGTGG + Intronic
904590404 1:31611711-31611733 TAAACTAAACATTTTGAGTTGGG - Intergenic
905976817 1:42181604-42181626 TTCAAGCATCAGTTGGAGTTTGG - Intronic
906474601 1:46160449-46160471 TTAAAAAGACAGTTTGAGCTAGG - Intronic
907611763 1:55878284-55878306 TTAAATAAGCATTTGGTGTTAGG - Intergenic
908539379 1:65108087-65108109 TTAAATAAATGGGTGGAGGTAGG - Intergenic
908794509 1:67817713-67817735 CTTAGTAAACAGTTGGTGTTTGG + Intronic
911910709 1:103631094-103631116 ATAAATAAGCCGTTGGTGTTAGG - Intergenic
911918124 1:103725219-103725241 ATAAATAAGCCGTTGGTGTTAGG - Intronic
913377411 1:118168288-118168310 TTAAGGGAAAAGTTGGAGTTTGG + Intronic
913592094 1:120340118-120340140 TTAAATTCACAATTGGATTTGGG + Intergenic
913651262 1:120915028-120915050 TTAAATTCACAATTGGATTTGGG - Intergenic
914045508 1:144088354-144088376 TTATATAAAAATTTGGAGATGGG - Intergenic
914132602 1:144872331-144872353 TTATATAAAAATTTGGAGATGGG + Intergenic
914169847 1:145214039-145214061 TTAAATTCACAATTGGATTTGGG + Intergenic
915050876 1:153070949-153070971 TTAAATAAATTTTTGGAGATTGG - Intergenic
915052790 1:153093861-153093883 TTAAATAAATTTTTGGAGATTGG - Intronic
916899884 1:169210096-169210118 TTAAATACACTGTGGGTGTTGGG - Intronic
918879952 1:190105017-190105039 TTAAATATAAATTTGGAATTAGG + Intronic
921171076 1:212550219-212550241 TGAAATAAAAATTTGGAGATAGG - Intergenic
924322278 1:242862164-242862186 TTAAATAAACAGATGGGTTATGG + Intergenic
924655697 1:245973375-245973397 TTTAATAAACATTTGCAGATTGG - Intronic
924937555 1:248784869-248784891 TTAAATAAATAATTGTAATTCGG + Intergenic
1064196296 10:13246530-13246552 TTAAAAAAACACTTGCAGTAGGG + Intergenic
1064506674 10:16038602-16038624 TTAAATAAACTGATGAATTTGGG + Intergenic
1064657187 10:17567979-17568001 TTAAAAATTAAGTTGGAGTTAGG + Intergenic
1065763944 10:29009082-29009104 TCAAATGAACAGTTTGAATTTGG + Intergenic
1066493020 10:35912884-35912906 TTTAAAAAACAGATGGAGATGGG + Intergenic
1066976596 10:42374314-42374336 TTAAATACACAGTTGGTGGCTGG + Intergenic
1068047580 10:51907250-51907272 TGAAAAAAAAACTTGGAGTTTGG - Intronic
1068520189 10:58069060-58069082 GAAAATAAACAGTTGGAGATGGG - Intergenic
1071893433 10:90038090-90038112 CTAAATAAACAGTTGTTGATAGG + Intergenic
1072767769 10:98109644-98109666 TAAAAGAAACAGTTGGAGGCTGG - Intergenic
1073551234 10:104403618-104403640 TTATATAAAAAGTTGGAGTTAGG - Intronic
1073859371 10:107719957-107719979 TTAAATAACCAGGAGCAGTTGGG + Intergenic
1075268514 10:121027191-121027213 TTAAATAAAATTTTGAAGTTTGG + Intergenic
1076095137 10:127727613-127727635 TTAAATAAAAAATTTGAGGTGGG + Intergenic
1077828807 11:5840941-5840963 ATCACTAACCAGTTGGAGTTTGG - Exonic
1078366323 11:10709406-10709428 TTAAACAAACAACAGGAGTTTGG - Intergenic
1078496716 11:11824906-11824928 GTAAATCAAGAATTGGAGTTTGG - Intergenic
1079456606 11:20641974-20641996 ATAAATAAACACTGGGACTTAGG + Intronic
1079961733 11:26932720-26932742 TTAAAGAAAAAATGGGAGTTTGG - Intergenic
1080080438 11:28211749-28211771 TTAAAGAAACATTTTGAATTAGG + Intronic
1081497063 11:43622472-43622494 TTAAAAAAACAGTTGGACTTTGG + Intronic
1081554875 11:44149358-44149380 TCTTAAAAACAGTTGGAGTTTGG + Intronic
1084652979 11:70499891-70499913 TTAATTAATCCCTTGGAGTTGGG - Intronic
1088112167 11:106274859-106274881 TAAAATAAACATTGGTAGTTTGG + Intergenic
1088478212 11:110266359-110266381 GTAAATAAAGTGGTGGAGTTAGG + Intronic
1088952558 11:114586398-114586420 TGAAATAAAAAGAAGGAGTTGGG - Intronic
1090317981 11:125813759-125813781 TGAAACAAACAGTTGGTTTTGGG - Intergenic
1091664348 12:2408267-2408289 TTAAATACAGAGTTTCAGTTTGG + Intronic
1092072349 12:5641759-5641781 TTATATCAAGATTTGGAGTTGGG + Intronic
1092710261 12:11329064-11329086 ATAATAAAACAGTTGTAGTTTGG + Intergenic
1093130109 12:15381545-15381567 TTAAAGCAACAGTTGAGGTTTGG - Intronic
1093647949 12:21610468-21610490 TGAAATAATCAGCTGGAGCTGGG + Intergenic
1095652158 12:44624359-44624381 TAAAATATACACTTGCAGTTGGG - Intronic
1096644576 12:53024088-53024110 ATAATTAAACAGTTGGGGTGCGG + Intronic
1096753295 12:53777203-53777225 CTAAATAAACATATAGAGTTTGG - Intergenic
1097938188 12:65277024-65277046 TTAAACAAACATTTGGACTATGG + Intergenic
1098516566 12:71384028-71384050 TTAAATTAACTTTTGGAGGTGGG - Intronic
1098582207 12:72113591-72113613 GTAATTAAAGAGTTGGAATTGGG - Intronic
1098982715 12:76974884-76974906 TGAAAGAAAGAGTTTGAGTTAGG + Intergenic
1099266907 12:80459107-80459129 TAAAATAAAAAACTGGAGTTGGG - Intronic
1101011131 12:100450701-100450723 TTTAATAAACATTTGAATTTTGG + Intergenic
1101092423 12:101301355-101301377 TTAAATAGAGAGTCAGAGTTGGG - Intronic
1101540618 12:105661682-105661704 TTACATTAAAAGTTAGAGTTTGG + Intergenic
1103204001 12:119114040-119114062 TTTAATAATCAGTTGGTGTTTGG + Intronic
1104823950 12:131695142-131695164 TTAAGAAAAAAGTTGGAGTCCGG - Intergenic
1106872209 13:34033932-34033954 GTACATAAAAAGTTAGAGTTTGG + Intergenic
1107829255 13:44359846-44359868 TTAGTTTAACAGTTGGAGTGTGG - Intergenic
1108295051 13:49007775-49007797 TTAAAGGAGCAGGTGGAGTTAGG + Intronic
1108320071 13:49281188-49281210 TTAGCTGAACAGTTGCAGTTAGG - Intronic
1109274579 13:60289719-60289741 TTAAAAAAATAATTGTAGTTTGG - Intergenic
1109383556 13:61597863-61597885 GTAAATAAATATCTGGAGTTTGG + Intergenic
1109430985 13:62234895-62234917 TAAAATAAACTGTTGCTGTTTGG - Intergenic
1109788256 13:67211482-67211504 TTAAATAAAAATTTGAAATTTGG + Intronic
1109896798 13:68703065-68703087 TTAAGAAAACAGTTGCATTTAGG + Intergenic
1110071153 13:71179585-71179607 TTAAATAAAAAGTTGAAAATAGG + Intergenic
1110900354 13:80814828-80814850 TCTAAGAAACAGATGGAGTTTGG + Intergenic
1111246726 13:85550456-85550478 TTAAATATCCAGTTGTAGTAAGG - Intergenic
1111715992 13:91879374-91879396 TTAAATAAATATCTGGAATTGGG + Intronic
1111761737 13:92475107-92475129 GAAAATAAACAGTTGAAGTCAGG + Intronic
1111855165 13:93627916-93627938 TTAACTGAACAGTTGTAGTAGGG + Intronic
1114754021 14:25238154-25238176 TTAAATAACCACATGGGGTTAGG - Intergenic
1115870000 14:37789370-37789392 TTAAAAAATCAGCTGCAGTTTGG - Intronic
1116098098 14:40398149-40398171 TTAAATAAACAGCATGTGTTAGG + Intergenic
1116397102 14:44459737-44459759 TGAAATAAAGAGTTGGTTTTTGG + Intergenic
1116537463 14:46051308-46051330 TTAGATTCACAGCTGGAGTTTGG - Intergenic
1116610564 14:47066062-47066084 TTAAATAAGCAGTTGGAAATAGG + Intronic
1116667279 14:47793834-47793856 TTAAATTAATAGATGGAATTGGG + Intergenic
1118685865 14:68290600-68290622 TTAAATACACAGTGAGACTTTGG + Intronic
1119042626 14:71288779-71288801 TTAAAAAAAAAGTTAGAGATGGG - Intergenic
1119212324 14:72841504-72841526 TTCAGTAAAAAGTTGGGGTTAGG + Intronic
1119443666 14:74646662-74646684 TTACATAAAAAACTGGAGTTTGG + Intergenic
1119585188 14:75827425-75827447 TTAAATAAACATTTAAAATTTGG - Intronic
1119814719 14:77555569-77555591 TTAAATCAAAATTGGGAGTTTGG + Intronic
1120700674 14:87695638-87695660 ATAAATAAACAGTTGCTTTTGGG - Intergenic
1122948789 14:105029024-105029046 TTAAATAAAAGGTTGTATTTGGG - Intergenic
1125069289 15:35532731-35532753 TTTAAAAAACAGTTGGACATTGG - Intronic
1125478986 15:40067450-40067472 TTAATAAAATAGTTGGGGTTGGG - Intergenic
1127034228 15:54896982-54897004 TTGACTGAACAGTTGGAGTTGGG - Intergenic
1127055260 15:55125075-55125097 TTAAATAAAGAGTTGGGGTGAGG + Intergenic
1127178946 15:56393887-56393909 TTAAATAATCTGATGTAGTTTGG + Intronic
1127737551 15:61858307-61858329 ATAGATAGATAGTTGGAGTTTGG - Intronic
1127946396 15:63758889-63758911 TTAAAAAAAAAGTTGGGGGTGGG - Intronic
1128230143 15:66029085-66029107 TCAAATGAACAGTTGGATTCTGG + Intronic
1128585850 15:68849502-68849524 TTAAGTAGCCAGGTGGAGTTTGG - Intronic
1129477241 15:75794050-75794072 TGAAATAAAAAGTTGGTTTTTGG - Intergenic
1131079798 15:89525364-89525386 TTAAAAAAACACTTTGATTTAGG + Intergenic
1131107129 15:89742856-89742878 TTATAAAGACAGTTTGAGTTGGG - Intronic
1131180891 15:90239106-90239128 CTATATAAACAGTTGAAGATTGG + Intronic
1131365281 15:91833850-91833872 TGAAGTTAACAGTTGAAGTTAGG - Intergenic
1131607107 15:93918048-93918070 TTAAATAAACTGTCCAAGTTGGG + Intergenic
1134322007 16:13172356-13172378 TTAATTAAACAGGTGGCTTTAGG + Intronic
1134901968 16:17946477-17946499 TTAAATAAAGAGATGGACTGTGG + Intergenic
1135658505 16:24273198-24273220 TTAAAAAAGCAATTGGACTTAGG - Intronic
1138922040 16:61543121-61543143 CTAACTAGACATTTGGAGTTGGG - Intergenic
1139379026 16:66518907-66518929 TCAAATCAGCAGTGGGAGTTGGG + Intronic
1141226723 16:82123274-82123296 TGAAATAAAAAGTTGGTTTTTGG + Intergenic
1144396352 17:14847342-14847364 TAAAATTATCAGTTTGAGTTTGG - Intergenic
1144462757 17:15470962-15470984 TTTAATTAACAGTTGCAGATTGG + Intronic
1146949015 17:36892838-36892860 GAAAATGAAGAGTTGGAGTTTGG - Intergenic
1146974487 17:37099253-37099275 TTAAAAAAAGAGGTAGAGTTGGG - Intronic
1147203899 17:38823136-38823158 TTAAAAAAAAAGTTGGAGTCAGG - Intronic
1150049415 17:61945877-61945899 TTAATTAAAAAGTTGCAGTAGGG - Exonic
1150097183 17:62387797-62387819 TTAAATAAATATTTGTTGTTTGG - Intronic
1154140485 18:11819960-11819982 TAAAAAAAAAAGTTAGAGTTGGG + Intronic
1154308680 18:13250436-13250458 TGAAACAAAAAGTTGGATTTTGG + Intronic
1154998440 18:21663570-21663592 TTAAAATAACAGCTGGAGTAGGG + Intronic
1155644290 18:28058725-28058747 TTAAATAAACAGTCGGATTAGGG - Intronic
1156584133 18:38413250-38413272 TTAAATAAACAGGTGAATTAAGG - Intergenic
1156945392 18:42823319-42823341 TTAAATAATCAGTTAGGGATTGG - Intronic
1157049778 18:44149399-44149421 TAAAATAAGCAGTAAGAGTTTGG - Intergenic
1157843383 18:50980040-50980062 TTAAATAAACAGTTGGAGTTGGG + Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158348662 18:56541623-56541645 TTATATAAACAGGTTGATTTAGG - Intergenic
1159458770 18:68695423-68695445 TCAAATAAGCAGTTGGACATAGG - Intronic
1159546743 18:69849124-69849146 TTATATTAAAAGATGGAGTTAGG - Intronic
1163511353 19:17737112-17737134 TTAAAAAAAAAGTTGCAGTTTGG - Intergenic
1163657962 19:18558713-18558735 ATAAATCTACATTTGGAGTTGGG + Intronic
1165220029 19:34308533-34308555 TTAATTAAGCAGCTGGAATTTGG + Intronic
1165264983 19:34654324-34654346 TTACATAAACAGTTGAGTTTTGG - Intronic
1166264909 19:41674239-41674261 TTGAATAAACAGTTGTATTAGGG + Exonic
1166565195 19:43760669-43760691 TCAAATAAGTGGTTGGAGTTAGG + Intergenic
1166778410 19:45326415-45326437 TTAAAGAAACAGTTGGCCTTGGG + Intergenic
1167181161 19:47904523-47904545 TCAAATAAGCATTTGGAGATGGG + Intergenic
1167182478 19:47915273-47915295 TCAAATAAGCATTTGGAGATGGG + Intergenic
1167183146 19:47920625-47920647 TCAAATAAGCATTTGGAGATGGG + Intergenic
1167184443 19:47931025-47931047 TCAAATAAGCATTTGGAGATGGG + Intergenic
1167185115 19:47936376-47936398 TCAAATAAGCATTTGGAGATGGG + Intergenic
1167185768 19:47941765-47941787 TCAAATAAGCATTTGGAGATGGG + Intergenic
1167542106 19:50095738-50095760 TCAAATAAGCATTTGGAGATGGG - Intergenic
1167544086 19:50110275-50110297 TCAAATAAGCATTTGGAGATGGG - Intergenic
1167544761 19:50115628-50115650 TCAAATAAGCATTTGGAGATGGG - Intergenic
1167545436 19:50120980-50121002 TCAAATAAGCATTTGGAGATGGG - Intergenic
1167546113 19:50126335-50126357 TCAAATAAGCATTTGGAGATGGG - Intergenic
1167546790 19:50131670-50131692 TCAAATAAGCATTTGGAGATGGG - Intergenic
1202685067 1_KI270712v1_random:41762-41784 TTATATAAAAATTTGGAGATGGG - Intergenic
925964405 2:9050477-9050499 TTAATTAAATAGTTATAGTTGGG - Intergenic
926460650 2:13125780-13125802 GGACAAAAACAGTTGGAGTTTGG - Intergenic
928960559 2:36921642-36921664 TTATATAAAAATTTGGAGATGGG - Intronic
929380502 2:41345151-41345173 TTAAATAAAAATTTAAAGTTTGG + Intergenic
930708023 2:54523532-54523554 TTAAATAAACAGTAGGCTCTTGG - Intronic
932101398 2:68902987-68903009 TGAAATAAAAAGTTGGTATTTGG + Intergenic
933279613 2:80318491-80318513 CTATATAAAGAGTGGGAGTTGGG + Intronic
933402405 2:81815304-81815326 TTAAATAAAAAATTGGAATTTGG + Intergenic
934246652 2:90313095-90313117 TTATATAAAAATTTGGAGATGGG + Intergenic
935014635 2:99168993-99169015 TTAAAGAGACAGATGGAGCTTGG - Intronic
937105281 2:119306454-119306476 TCAGATAAACACTTAGAGTTTGG + Intronic
937372155 2:121306318-121306340 TTAAATAAACAACTGGAGACTGG + Intergenic
937532644 2:122847559-122847581 TTGAATAAACAACTGCAGTTTGG - Intergenic
938048034 2:128140652-128140674 TAAAATAAACAGTGGGTGGTGGG - Intronic
938393704 2:130925443-130925465 TTAAATAAACTGTGAGATTTAGG - Intronic
940185501 2:150980599-150980621 TTAAATGAACACTTGGCATTTGG - Intergenic
940195341 2:151088220-151088242 TAAAATAAACTCTTGGGGTTAGG - Intergenic
940879874 2:158935876-158935898 TTAAATTAATATTTGGAATTGGG - Intergenic
941311936 2:163943959-163943981 TTAAATGAACAATATGAGTTAGG + Intergenic
941911955 2:170772004-170772026 TTAAAAAATAAGTTGGATTTGGG - Intergenic
943113272 2:183634375-183634397 TTAAATAAAAAGTTAGAATATGG - Intergenic
943559058 2:189439607-189439629 TTAATTAAACAGCTGTAGGTGGG + Intergenic
946100833 2:217320226-217320248 TTACATAAATACATGGAGTTAGG - Intronic
946120632 2:217510865-217510887 TTAAATATACAGTTGTAGATAGG + Intronic
947327809 2:228997082-228997104 TTAAATAACCTAGTGGAGTTAGG + Intronic
947553976 2:231072689-231072711 TTAAAAAAACAGGTGGGGATAGG + Intronic
1169032271 20:2418761-2418783 TTAAAGAAACAGTTGGAATAAGG - Intronic
1169797048 20:9474238-9474260 CTAACTAAACAGTTGGTGTTTGG - Intronic
1170713501 20:18812662-18812684 AGAAATAAACAGGTGGACTTTGG + Intronic
1171102369 20:22397197-22397219 TTTAATAAACAGTAAGACTTTGG + Intergenic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1174910871 20:54606263-54606285 TTAAAAAAAAAGTTTAAGTTAGG - Intronic
1178815103 21:35922066-35922088 TGATATAAAGAGCTGGAGTTGGG - Intronic
1182452096 22:30427754-30427776 TCAAATATTCAGTTTGAGTTAGG - Intronic
1184745506 22:46453433-46453455 TTAATTCATCACTTGGAGTTGGG + Intronic
949587433 3:5455529-5455551 TTGATTAAGCAGTTTGAGTTGGG + Intergenic
949761729 3:7478541-7478563 TTTAATAATCAGTGAGAGTTAGG + Intronic
951269022 3:20602853-20602875 TTAAATAATCAGGTGGAGACAGG + Intergenic
951618461 3:24574648-24574670 GTAAATAAACAGTTGTGGCTGGG - Intergenic
951974619 3:28491226-28491248 TTAAATATACAGCTGGATATAGG + Intronic
954819615 3:53314454-53314476 TTAAATAAACAATTCATGTTTGG - Intronic
958606884 3:96369908-96369930 TAAAATAAAAAGCTGCAGTTGGG - Intergenic
959312464 3:104756583-104756605 TAAAATCAAAAGTTGCAGTTGGG - Intergenic
959404831 3:105948436-105948458 TTAAATAAACATTTTGTTTTAGG + Intergenic
961072673 3:123949656-123949678 TGAAATGAAAAATTGGAGTTGGG - Intronic
962192989 3:133330743-133330765 TTAAAAAAACAGATGCAATTTGG - Intronic
962546870 3:136445483-136445505 TAAAATAAAGAGTTTCAGTTTGG + Intronic
962699889 3:137987389-137987411 CTAAATAAACAGTGGGAGAAAGG + Intergenic
963199311 3:142569938-142569960 ATAAAAAAACAGTTGGGGCTGGG - Intronic
963793930 3:149612504-149612526 GTAAGTAAACAGGTGGTGTTCGG + Intronic
964169067 3:153745535-153745557 TTAAATGAACAAATGGATTTGGG + Intergenic
964333841 3:155633953-155633975 TTAAAAAAAAAGATGGAGTCAGG - Intronic
964832581 3:160901524-160901546 TTAAATAAACACTTGCTGTGAGG - Intronic
964915049 3:161830342-161830364 TTAAATAAAATATTGGAGTTGGG + Intergenic
966238003 3:177724343-177724365 CTAAATAAACATTTGGAATAGGG - Intergenic
966466448 3:180235312-180235334 TTGCATGAACATTTGGAGTTTGG - Intergenic
967764899 3:193268662-193268684 ATAAATGAACATTTGGAATTGGG + Intronic
967805373 3:193710920-193710942 AGAAAGAAACAGTGGGAGTTGGG + Intergenic
970903434 4:21186933-21186955 TTAAATAAAAAGATTGAGCTGGG - Intronic
971865264 4:32162067-32162089 TTAAATAAGCAGCAGGATTTAGG + Intergenic
972100636 4:35410281-35410303 TTAATTCTACAGATGGAGTTGGG - Intergenic
972157260 4:36179906-36179928 TTTAATAAACATTTTGACTTTGG - Intronic
972517746 4:39824560-39824582 TTTAAAAAATAGTTGGACTTTGG - Exonic
973166480 4:47084178-47084200 TTAAATAAACAGAATGTGTTGGG + Intronic
973388968 4:49536549-49536571 TTTGAAAAACAGTTGGTGTTTGG + Intergenic
973808948 4:54551627-54551649 TTAAAAAACCAAATGGAGTTGGG + Intergenic
973973144 4:56235140-56235162 TTAAAGATACAGTGGGAGTAGGG + Intronic
974341687 4:60621753-60621775 TTTATTAAACAATTTGAGTTTGG - Intergenic
974646297 4:64697587-64697609 TGAAATACAAAGTTGGATTTGGG - Intergenic
974902069 4:68013299-68013321 TTAAAATAACACTGGGAGTTGGG + Intergenic
975114946 4:70670087-70670109 TAAAATAAAAAGTTGGACATAGG - Intronic
975391189 4:73819466-73819488 TTAAAGAAACAGATGGATATGGG + Intergenic
975508748 4:75169098-75169120 TCCAACAAGCAGTTGGAGTTTGG - Intergenic
975957023 4:79853358-79853380 GTAAAGAAAAAGTTGGAGGTAGG - Intergenic
976144464 4:82028174-82028196 TTAAATACATAGTTAGAATTTGG - Intronic
977140793 4:93369288-93369310 TTAAACAAACAGTTGTCATTGGG + Intronic
977439507 4:97045318-97045340 TTAAATGACCAGTTGGCATTTGG - Intergenic
978088309 4:104683113-104683135 TTAAATAGATTGTTGGATTTAGG - Intergenic
978221350 4:106278954-106278976 CTAAATAAGCACTTGGAATTAGG - Intronic
979264278 4:118683296-118683318 TTTACAAAACTGTTGGAGTTGGG - Intergenic
979454166 4:120907698-120907720 GTAAATAAACATTTTGTGTTGGG - Intronic
979700652 4:123663689-123663711 TTAAATAAATCCTTGGAGTGAGG - Intergenic
979949066 4:126868749-126868771 TTAAATAAAATATTAGAGTTTGG - Intergenic
980722004 4:136709994-136710016 TTCAATTAACATTTGGTGTTGGG + Intergenic
981227608 4:142314972-142314994 TTAGATAAATAGATGGAGTGAGG - Intronic
981601643 4:146495847-146495869 TTAAAGAAACATTTTGATTTGGG - Intronic
982489316 4:156008969-156008991 TTAAAGAAACTATTGCAGTTCGG - Intergenic
982545468 4:156726934-156726956 TTAAAAATACAGTTGGACCTGGG + Intergenic
982712916 4:158776082-158776104 TTAAATAAATGATTGGTGTTTGG + Intronic
982936558 4:161485071-161485093 TTAAATGAATAGTTGTAGTTGGG - Intronic
983477618 4:168233824-168233846 TTGGAGAAACAGTTGGTGTTTGG - Intronic
984369578 4:178845583-178845605 TAACATAAAAAGATGGAGTTTGG + Intergenic
984479784 4:180285218-180285240 TTAAACAAACAATTAGAGATTGG + Intergenic
985086975 4:186323884-186323906 TTAGATAAACAGTTGCAGGAGGG + Intergenic
986694883 5:10342806-10342828 TTAAATATACAGTTGGGGCTGGG - Intergenic
986800208 5:11251809-11251831 ATAAATAAAAACTTGTAGTTTGG + Intronic
987452110 5:18098177-18098199 TTAATTAAACAGGTTGAGGTAGG + Intergenic
987793090 5:22593652-22593674 TTTAATAACCACTTGGAGTTAGG - Intronic
987896164 5:23950006-23950028 TTACATAAACAGTTAAATTTTGG - Intergenic
988615081 5:32767637-32767659 AAAATTAAACTGTTGGAGTTGGG + Intronic
988839318 5:35067609-35067631 TGAAATAAATAGTTTCAGTTTGG - Intronic
989089581 5:37716135-37716157 TGAAAAAACCAGATGGAGTTTGG + Intronic
990909099 5:60836089-60836111 GTGAATAAACAGTTGGATGTTGG - Intronic
991391007 5:66143882-66143904 TTTTAAAAATAGTTGGAGTTGGG + Intronic
992753955 5:79886835-79886857 TATAACAAACAGCTGGAGTTAGG - Intergenic
993016220 5:82537415-82537437 TTTAATAAATAGTTGTAGTGAGG + Intergenic
993396699 5:87398250-87398272 TTACCTATACAGTTGTAGTTGGG - Intronic
994495646 5:100509072-100509094 TAAATTAAACTGATGGAGTTAGG + Intergenic
994731148 5:103492158-103492180 TTTAATAAAAAGTTTGATTTAGG + Intergenic
994884588 5:105543249-105543271 TTAAAAAAAGAGTTGGAGAAGGG + Intergenic
996012531 5:118497153-118497175 TGAAATAAAAAATTGGAGTAGGG + Intergenic
996110796 5:119564156-119564178 TTGAATAATCAGTTGAAGTTGGG + Intronic
996224447 5:120973977-120973999 TTAAAAATGCAGTAGGAGTTTGG - Intergenic
996322810 5:122238298-122238320 TTAATTAAACATTTGGGGTGGGG + Intergenic
997542801 5:134678243-134678265 TTAAATAACCAGTTAAACTTTGG - Intronic
999353564 5:150902618-150902640 TTATAAAAACAGTTGGAGAATGG + Intronic
999486876 5:152005491-152005513 TACAATAAACAGAGGGAGTTGGG - Intergenic
999832686 5:155335867-155335889 TCAAAGAAGCAGTTGGACTTGGG - Intergenic
999952068 5:156661982-156662004 AAAAATAAAAAGTTGGAGTGGGG + Intronic
1000762743 5:165246259-165246281 ATAAATAAACAGGAGGAGTGTGG + Intergenic
1001673874 5:173496526-173496548 TTAAAAAAACAGTGTGATTTTGG - Intergenic
1004245262 6:13969290-13969312 TCAAATAAAGAGTTGCAGTCAGG + Intronic
1004345553 6:14846046-14846068 TCAAATAAAAAGTGGGATTTTGG - Intergenic
1006715751 6:36118915-36118937 TTACATAAACACTTGGAGGGGGG - Intergenic
1007678643 6:43618929-43618951 TAAAATAAAAAGTAGAAGTTGGG - Intronic
1007912858 6:45533739-45533761 TTAAATAAAAGGTAGTAGTTTGG + Intronic
1007972169 6:46063210-46063232 TTCAAGAATGAGTTGGAGTTTGG - Intronic
1008195409 6:48513342-48513364 TGAAATAAATAGTTTGATTTTGG - Intergenic
1009337893 6:62516278-62516300 TTAAAAAAAAAGTTGAAGTAGGG - Intergenic
1010839587 6:80632920-80632942 TCATATAAACAGTTGGGTTTGGG - Intergenic
1011715016 6:90096431-90096453 GTAAATAAACATGTGGATTTTGG - Intronic
1012532736 6:100257922-100257944 TGAAATAAACAGCTGAAGTCAGG - Intergenic
1013374281 6:109499010-109499032 TTTAGTAAATATTTGGAGTTAGG + Intronic
1014006679 6:116427467-116427489 TTAAATATATAATTGGAGATTGG + Intronic
1014256531 6:119165797-119165819 TTATATGAAAATTTGGAGTTAGG + Intergenic
1014258858 6:119193179-119193201 TTAAATGAAGCGGTGGAGTTGGG - Intronic
1014866339 6:126534904-126534926 TTAAATAAACTTTTGCAGCTTGG + Intergenic
1015098086 6:129441302-129441324 TTAAAAACACAGTTGTACTTGGG + Intronic
1015196773 6:130532224-130532246 TTGAAAAAATAGATGGAGTTAGG - Intergenic
1015996592 6:139000776-139000798 ATAAAGAAAGACTTGGAGTTGGG + Intergenic
1016653372 6:146488712-146488734 TTAAAAAAATAGTTTGTGTTTGG + Intergenic
1017029699 6:150210369-150210391 AGGAATAAACAGATGGAGTTTGG - Intronic
1017031298 6:150225130-150225152 TTAAATAAACTTTTAGACTTTGG + Intronic
1017402291 6:154078260-154078282 TTAAATAGGCAGTTGGAATATGG - Intronic
1018307392 6:162472198-162472220 ATAAAAAAAAAGTTTGAGTTTGG - Intronic
1018618793 6:165711196-165711218 CTAAATACACCGTTAGAGTTGGG + Intronic
1018996409 6:168713791-168713813 ATAAATAAAAAGTTTGATTTAGG - Intergenic
1020390757 7:7655413-7655435 TTAAATGAAAAGTTTCAGTTTGG + Intronic
1021305845 7:19031142-19031164 TAAAATAAACATCTGAAGTTTGG - Intronic
1021684268 7:23167480-23167502 TTATATAAACATTTGAAGTATGG + Intronic
1021856197 7:24858968-24858990 TAAAATAATCAGTTGCAATTAGG - Intronic
1023244699 7:38188857-38188879 TTTAAAAAACAGTCGGAGTTCGG + Intronic
1023373104 7:39531304-39531326 TTAAAAGAACACTTGGAATTTGG - Intergenic
1023715414 7:43038979-43039001 TTAAATAAAGAGTTGAACTAAGG + Intergenic
1024464888 7:49701534-49701556 TAAAACAAAAAGTTGGAGATGGG - Intergenic
1024702413 7:51918468-51918490 CTGAATAAACAGCTGGTGTTTGG - Intergenic
1025730987 7:64107457-64107479 TTAATTAAATAGTTGGAGGTTGG + Intronic
1028224406 7:88233266-88233288 TTAAATATACAGTTTGATTTTGG + Intergenic
1028550838 7:92063231-92063253 TTAATTAAACAGGTTTAGTTTGG + Intronic
1028641370 7:93045308-93045330 TTAAATATACAGTGGGATTTAGG + Intergenic
1028881190 7:95881806-95881828 TTAAGTAAGCAGTTTGAGTCAGG + Intronic
1029134776 7:98361681-98361703 TAAATTAAACAGTTGGACTTAGG - Intronic
1030922279 7:115406485-115406507 TTGAATAAACACTTGGAGTCAGG + Intergenic
1031419304 7:121530764-121530786 TTGAATAAACAGCTGTACTTTGG - Intergenic
1032844927 7:135744350-135744372 TTAAAAATACAGTTGGAGTTTGG - Intronic
1033901959 7:146154283-146154305 TTAAAAATAAAATTGGAGTTGGG - Intronic
1035006538 7:155666335-155666357 TTACCCAAAAAGTTGGAGTTGGG - Intronic
1035836054 8:2753172-2753194 TTAAATGAAAAGGAGGAGTTAGG + Intergenic
1037015085 8:13894387-13894409 TTAAATAATCAGTTTAATTTTGG + Intergenic
1041346890 8:56908838-56908860 TAAAAGAAAGTGTTGGAGTTAGG + Intergenic
1041448494 8:57980544-57980566 TTTAAAAAAAAGTTGGAATTAGG - Intergenic
1041945342 8:63434463-63434485 TGAATTAAACATTTGGACTTGGG + Intergenic
1042415660 8:68514809-68514831 TTACCCAAATAGTTGGAGTTGGG + Intronic
1042459431 8:69045998-69046020 ATAAATGAACTGTTGGAGATAGG + Intergenic
1042516783 8:69667406-69667428 CTAAATTAACATTTGGGGTTTGG + Exonic
1042985931 8:74582882-74582904 TTACAAAAACAGATGGAGGTGGG + Intergenic
1043071952 8:75648191-75648213 TTAGATAAACAATTGGAACTAGG + Intergenic
1043431873 8:80203058-80203080 ATAATTAAATAGTTTGAGTTGGG - Intronic
1044802292 8:95969605-95969627 TTAGATAAACAGCTGGTGATTGG - Intergenic
1044921376 8:97172927-97172949 CTAAAGGAACAGTTTGAGTTAGG - Intergenic
1045944176 8:107776690-107776712 TTTAAAAAAAAGTTGGAGTCAGG + Intergenic
1046420034 8:113969249-113969271 TTAAATAAATTGTTGAAATTAGG + Intergenic
1046809100 8:118513651-118513673 TCAAGTAGACAGTTGGGGTTGGG + Intronic
1046812314 8:118546271-118546293 TTAAATGAAGAGGTGGAATTGGG + Intronic
1047109872 8:121777678-121777700 TTCAATAAATAGTGGCAGTTTGG - Intergenic
1050631815 9:7567506-7567528 TTAAATAAAAAGATGTTGTTTGG - Intergenic
1050670141 9:7987355-7987377 TGAGATAATCAGTTGGTGTTTGG + Intergenic
1050884686 9:10749418-10749440 TTAAATAAAGATTTAGAGATGGG + Intergenic
1051432819 9:16997887-16997909 TTAAATTAAGAGATGGAGTAAGG - Intergenic
1052166368 9:25335008-25335030 TTCAAGAAACAATAGGAGTTAGG - Intergenic
1052470417 9:28887357-28887379 TTAAAAAAACTGTTGGCATTAGG + Intergenic
1055767329 9:79678403-79678425 TTAAAAAAAAAGATGAAGTTAGG - Intronic
1055817790 9:80227946-80227968 TTAAATTCACAGAAGGAGTTAGG + Intergenic
1055877733 9:80963213-80963235 AAAAAAAAAGAGTTGGAGTTTGG + Intergenic
1055959929 9:81810633-81810655 GTAAATAAATAGATGGAGCTGGG + Intergenic
1057433012 9:95012390-95012412 TTATATAAAATGTTAGAGTTCGG + Intronic
1057587926 9:96346261-96346283 TCAAAGAAACAGTTAGACTTGGG + Intronic
1057613120 9:96564574-96564596 TTGAATGAACAGTTTAAGTTTGG - Intronic
1057895793 9:98907714-98907736 TTAACAAAAGTGTTGGAGTTTGG + Intergenic
1059033962 9:110733435-110733457 TTAACTAAACAGTGGGATTGAGG - Intronic
1059143053 9:111872480-111872502 TTAAATAATCACTTACAGTTTGG + Intergenic
1059560486 9:115329950-115329972 TTGAATAAAATGATGGAGTTAGG - Intronic
1061069136 9:128298006-128298028 TTAAATAAAGATTTGGGGCTGGG + Intergenic
1185978563 X:4749495-4749517 TTACAAAAACAGTTGAATTTCGG - Intergenic
1188515958 X:30986200-30986222 TTATATAAATGGTGGGAGTTGGG + Intergenic
1188593479 X:31867822-31867844 TTAAAATAACAACTGGAGTTAGG - Intronic
1189527767 X:41843274-41843296 TTAAATATAAAGTTAGACTTTGG + Intronic
1190117455 X:47635868-47635890 AAAAATAAACACTTGGAGTGGGG + Exonic
1191010974 X:55758750-55758772 GTAAATAAACTTTTGGTGTTAGG + Intronic
1191604675 X:63047982-63048004 TCAAATAAACAGGTGGAGAAAGG - Intergenic
1191721523 X:64232700-64232722 TGATATAAACATTTGGAATTAGG + Intergenic
1193990295 X:88299081-88299103 TTAAATACACAGCTGCAGTCAGG + Intergenic
1194667963 X:96696490-96696512 TTAGACAAAAAGTTGGAATTAGG + Intronic
1195134068 X:101886038-101886060 TTGAATGGACAGTTGGAGATTGG - Intronic
1197559882 X:128006797-128006819 ATAAATCTACAGTTGGAGTTGGG + Intergenic
1201280891 Y:12340938-12340960 TTAAACAAACAGGTGATGTTTGG + Intergenic
1201700408 Y:16875176-16875198 TTAAATTAACAGGAGGATTTGGG + Intergenic
1201743632 Y:17348432-17348454 TTATATCAACATCTGGAGTTGGG - Intergenic
1202588532 Y:26457687-26457709 TTATATAAAAATTTGGAGATGGG + Intergenic