ID: 1157846285

View in Genome Browser
Species Human (GRCh38)
Location 18:51006909-51006931
Sequence CTATCTGGAAGCACCTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 407}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157846285_1157846293 24 Left 1157846285 18:51006909-51006931 CCAGCTGAGGTGCTTCCAGATAG 0: 1
1: 0
2: 1
3: 49
4: 407
Right 1157846293 18:51006956-51006978 AGAAGAAGGTAGTTATGGTTAGG 0: 1
1: 0
2: 1
3: 22
4: 254
1157846285_1157846291 10 Left 1157846285 18:51006909-51006931 CCAGCTGAGGTGCTTCCAGATAG 0: 1
1: 0
2: 1
3: 49
4: 407
Right 1157846291 18:51006942-51006964 ACAGAATGGGTAGTAGAAGAAGG 0: 166
1: 213
2: 159
3: 134
4: 371
1157846285_1157846290 -3 Left 1157846285 18:51006909-51006931 CCAGCTGAGGTGCTTCCAGATAG 0: 1
1: 0
2: 1
3: 49
4: 407
Right 1157846290 18:51006929-51006951 TAGCAAAGGGAATACAGAATGGG 0: 1
1: 14
2: 255
3: 251
4: 467
1157846285_1157846292 19 Left 1157846285 18:51006909-51006931 CCAGCTGAGGTGCTTCCAGATAG 0: 1
1: 0
2: 1
3: 49
4: 407
Right 1157846292 18:51006951-51006973 GTAGTAGAAGAAGGTAGTTATGG 0: 1
1: 0
2: 1
3: 12
4: 152
1157846285_1157846294 25 Left 1157846285 18:51006909-51006931 CCAGCTGAGGTGCTTCCAGATAG 0: 1
1: 0
2: 1
3: 49
4: 407
Right 1157846294 18:51006957-51006979 GAAGAAGGTAGTTATGGTTAGGG 0: 1
1: 0
2: 0
3: 19
4: 181
1157846285_1157846289 -4 Left 1157846285 18:51006909-51006931 CCAGCTGAGGTGCTTCCAGATAG 0: 1
1: 0
2: 1
3: 49
4: 407
Right 1157846289 18:51006928-51006950 ATAGCAAAGGGAATACAGAATGG 0: 1
1: 15
2: 260
3: 291
4: 625

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157846285 Original CRISPR CTATCTGGAAGCACCTCAGC TGG (reversed) Intronic
904578027 1:31518060-31518082 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
905465510 1:38150072-38150094 CCTTCGGCAAGCACCTCAGCAGG - Intergenic
906050757 1:42869375-42869397 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
906879932 1:49578422-49578444 CCTTCAGCAAGCACCTCAGCAGG - Intronic
906930646 1:50166558-50166580 CCTTCAGCAAGCACCTCAGCAGG + Intronic
907831946 1:58072870-58072892 CTATTTGGAAGCACCGAATCTGG - Intronic
909548667 1:76875215-76875237 CCTTCAGCAAGCACCTCAGCAGG + Intronic
909579675 1:77219977-77219999 CTATCTGGAAGAGACACAGCTGG + Intergenic
909858649 1:80575076-80575098 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
910108985 1:83661729-83661751 CTATTTGAAAGCTCCCCAGCTGG + Intergenic
910349793 1:86282178-86282200 TTTTCAGCAAGCACCTCAGCTGG - Intergenic
910562166 1:88601925-88601947 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
910588492 1:88903688-88903710 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
910630482 1:89348223-89348245 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
910790562 1:91045401-91045423 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
910948489 1:92618673-92618695 CCTTCAGCAAGCACCTCAGCAGG - Intronic
911108896 1:94162740-94162762 CTTTCAGCAAGCACCTCAGCAGG + Intronic
911257062 1:95645396-95645418 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
911403630 1:97408199-97408221 CCTTCAGCAAGCACCTCAGCAGG - Intronic
911496931 1:98643218-98643240 CTTTCAGCAAGCACCTCAACTGG - Intergenic
911695984 1:100890952-100890974 CTTTCAGCAAGCACCTCAGCAGG - Intronic
912264963 1:108148128-108148150 GAATCTGGAAGCAGCTTAGCTGG - Intronic
912501836 1:110127750-110127772 CCCTCAGCAAGCACCTCAGCTGG - Intergenic
913039175 1:115006427-115006449 CCTTCAGCAAGCACCTCAGCTGG + Intergenic
913254299 1:116939965-116939987 CCATCTGCAACCACCTCAGCTGG + Intronic
914611346 1:149306064-149306086 CAATCTGGGAGCAGCTTAGCTGG - Intergenic
916635239 1:166661105-166661127 CCTTCAGCAAGCACCTCAGCTGG - Intergenic
917764803 1:178203975-178203997 CCTTCAGCAAGCACCTCAGCAGG - Intronic
917928078 1:179805640-179805662 CAAGCTGGAAGCACCTGAGGTGG + Intronic
918217266 1:182402890-182402912 CAATATGGATGAACCTCAGCTGG - Intergenic
918555340 1:185792691-185792713 CTAACTGGAAACTCCTCAGTAGG - Intronic
918774762 1:188612704-188612726 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
919040237 1:192377955-192377977 CTAACTGGTAGCACATCAGCAGG - Intergenic
919242076 1:194926476-194926498 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
919470711 1:197975949-197975971 CTATCTGGGAGCCCCTCTTCAGG + Intergenic
920197708 1:204240321-204240343 CCTTCAGCAAGCACCTCAGCAGG - Intronic
923426688 1:233877119-233877141 CCTTCCGCAAGCACCTCAGCTGG - Intergenic
924846859 1:247783181-247783203 CTTTCAGCAAGCACCTCAGCAGG + Intergenic
1063998144 10:11640544-11640566 CTATCTGCAGACACCACAGCAGG - Intergenic
1064445764 10:15391520-15391542 CTCTCAGCAAACACCTCAGCCGG + Intergenic
1066051208 10:31637485-31637507 CCTTCAGTAAGCACCTCAGCTGG + Intergenic
1066169814 10:32829280-32829302 CCTTCAGCAAGCACCTCAGCAGG - Intronic
1066957883 10:42189976-42189998 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1067125224 10:43510273-43510295 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1067470884 10:46536865-46536887 CTATATGGCACCACCTCACCAGG + Intergenic
1068447463 10:57140555-57140577 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1068502506 10:57858001-57858023 CTATCTGGCAGTACCCTAGCAGG + Intergenic
1069146024 10:64892387-64892409 CTTTCAGCAAGCACCTCAGCTGG - Intergenic
1069192036 10:65504407-65504429 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1069209689 10:65740952-65740974 CTTTCAGTAAGCACCTCAGCTGG + Intergenic
1069826650 10:71258817-71258839 CCATCTGGCAGCTCCTCTGCTGG - Intronic
1071033016 10:81206737-81206759 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1071266804 10:83972037-83972059 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1071378650 10:85035325-85035347 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1071937951 10:90551219-90551241 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1071942510 10:90605817-90605839 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1071946850 10:90655742-90655764 CCTTCAGCAAGCACCTCAGCTGG + Intergenic
1072208989 10:93229737-93229759 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1072249382 10:93569497-93569519 CACTCTGGAAGCACCACAGAGGG - Intronic
1073557632 10:104467861-104467883 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1073656400 10:105422526-105422548 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1073995609 10:109312823-109312845 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1074014261 10:109517759-109517781 GTATCTGGATGCAGCTTAGCTGG + Intergenic
1074041510 10:109793961-109793983 CCATCTGAGAGCACCTCAGCCGG + Intergenic
1074243932 10:111669020-111669042 CTTTCCGGAAGTACCTCAGCAGG + Intergenic
1077007714 11:366341-366363 CCCTCTGCAAGCACCTCTGCTGG - Intergenic
1077401646 11:2361124-2361146 CCCTCAGCAAGCACCTCAGCCGG - Intergenic
1078718464 11:13861562-13861584 CTGTCTTGAAGCACCTGCGCTGG - Intergenic
1080019909 11:27549761-27549783 CTTTCAGCAAGCACCTCAGCTGG + Intergenic
1080076869 11:28159466-28159488 CCTTCAGCAAGCACCTCAGCAGG - Intronic
1081110799 11:39130700-39130722 CTTTCAGCAAGCACCTCAGCAGG - Intergenic
1081208564 11:40303854-40303876 CTACCTGAAAGCACTTCATCAGG - Intronic
1082999919 11:59281805-59281827 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1083093404 11:60223067-60223089 CCTTCAGGAAGCACCTCAGCAGG - Intronic
1083134236 11:60656413-60656435 CTTTCAGCAAGCACCTCAGCAGG - Intergenic
1086141360 11:83504241-83504263 CCTTCAGCAAGCACCTCAGCAGG + Intronic
1086278877 11:85162415-85162437 CCTTCAGCAAGCACCTCAGCAGG - Intronic
1086990031 11:93292622-93292644 CTGTTAGCAAGCACCTCAGCTGG - Intergenic
1088157811 11:106829938-106829960 CCTTCAGCAAGCACCTCAGCAGG - Intronic
1088265707 11:107985553-107985575 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1088407339 11:109496721-109496743 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1089903888 11:122015556-122015578 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1090197004 11:124825385-124825407 CTTTCAGCAAGCACCTTAGCAGG + Intergenic
1090209212 11:124906115-124906137 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1092093901 12:5825889-5825911 CCTTCAGGAAGCACCTCAGCAGG - Intronic
1092381894 12:8003344-8003366 ATTTCAGCAAGCACCTCAGCAGG - Intergenic
1092841257 12:12543288-12543310 CTATCCTCAAGCACATCAGCAGG - Intronic
1093031537 12:14293676-14293698 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1093048661 12:14483156-14483178 CCTTCAGCAAGCACCTCAGCTGG + Intronic
1093645982 12:21585586-21585608 CCCTCAGCAAGCACCTCAGCAGG - Intronic
1093964817 12:25312881-25312903 CCTTCAGGAAGCACCTCAGTGGG - Intergenic
1095118718 12:38386980-38387002 CTCTCTGCAAGGACCTCAGTTGG - Intergenic
1095211402 12:39499110-39499132 CTACCAGGAAGCACCTGAGGTGG + Intergenic
1095855983 12:46861744-46861766 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1096779911 12:53985814-53985836 ACATCTGGAATCGCCTCAGCTGG + Exonic
1097016963 12:55994104-55994126 CTAAGTGGAAGAACCTAAGCTGG - Exonic
1097077270 12:56404333-56404355 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1097437562 12:59570322-59570344 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1097518534 12:60637974-60637996 CCATCAGCAAGCACCTCAGGAGG - Intergenic
1097821076 12:64129948-64129970 CCTTCAGCAAGCACCTCAGCAGG + Intronic
1097843071 12:64340812-64340834 CCTTCAGCAAGCACCTCAGCAGG + Intronic
1098731364 12:74039645-74039667 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1098750096 12:74281535-74281557 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1098807409 12:75036832-75036854 CCTTCAGCAAGCACCTCAGCTGG - Intergenic
1098855385 12:75646866-75646888 CTCTCTGGAAGCACTTCTGGAGG - Intergenic
1099183114 12:79490474-79490496 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1099400979 12:82203821-82203843 CCTTCTGCAAGCACCTCAGTGGG + Intergenic
1099490417 12:83282310-83282332 CCTTCAGTAAGCACCTCAGCAGG + Intergenic
1099632475 12:85168139-85168161 CCTTCAGCAAGCACCTCAGCAGG + Intronic
1099700620 12:86077619-86077641 CCTTCAGCAAGCACCTCAGCAGG + Intronic
1100260565 12:92929002-92929024 CTTTCTGGCAGCACGTGAGCGGG - Intronic
1100522955 12:95393735-95393757 CTATCTGGAAGTTGCTCAGAAGG + Intergenic
1100544874 12:95591914-95591936 CCTTCAGCAAGCACCTCAGCTGG - Intergenic
1101264406 12:103068064-103068086 CCTTCAGGAAACACCTCAGCAGG - Intergenic
1101534340 12:105603817-105603839 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1101912215 12:108868482-108868504 GAATCTGGAAGCAGCTCAGCTGG - Intronic
1102498840 12:113337469-113337491 ACATCTGGAAGGACCTCAGGAGG - Intronic
1105740440 13:23317409-23317431 CCTTCAGCAAGCACCTCAGCAGG - Intronic
1107983313 13:45754023-45754045 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1108914044 13:55586965-55586987 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1109516150 13:63444350-63444372 CCTTCAGAAAGCACCTCAGCAGG - Intergenic
1110740660 13:78991971-78991993 CCATCTGGGACGACCTCAGCTGG + Intergenic
1110833871 13:80062680-80062702 CTTTCAGCAAGCACCTCAGCAGG + Intergenic
1111057526 13:82971091-82971113 CCTTCAGTAAGCACCTCAGCAGG + Intergenic
1111198799 13:84906827-84906849 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1111317756 13:86583739-86583761 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1111536043 13:89604671-89604693 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1113111311 13:106827318-106827340 CTTTCAGCAAGCACCTCGGCTGG + Intergenic
1113603122 13:111585422-111585444 GTAGCTGGAACCACCACAGCTGG + Intergenic
1114206142 14:20572714-20572736 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1115130950 14:30051202-30051224 CCTTCAGCAAGCACCTCAGCAGG - Intronic
1116249308 14:42459576-42459598 CCTTCAGAAAGCACCTCAGCAGG - Intergenic
1116531204 14:45976295-45976317 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1117217119 14:53562098-53562120 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1117596000 14:57327937-57327959 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1118950493 14:70432635-70432657 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1119389833 14:74283665-74283687 CTAGCTAGAAGCAGCTCAGAGGG - Intergenic
1120481491 14:85054748-85054770 CCATCTGAGAGCACCTCAGCCGG + Intergenic
1123765041 15:23469989-23470011 CCTTCAGCAAGCACCTCAGCTGG + Intergenic
1123795506 15:23766516-23766538 CCATCTGAGACCACCTCAGCCGG - Intergenic
1127357053 15:58210173-58210195 CCTTCAGCAAGCACCTCAGCAGG - Intronic
1130377180 15:83339637-83339659 CCCTCAGCAAGCACCTCAGCTGG - Intergenic
1135061361 16:19273877-19273899 CTTTCAGCAAACACCTCAGCTGG + Intergenic
1136746304 16:32594956-32594978 CTGGCTGGGAACACCTCAGCTGG - Intergenic
1137765510 16:50974854-50974876 CCATCTGGCAGCACCTCACTTGG - Intergenic
1139848918 16:69939197-69939219 CTTCCTGGAAGCACGTCAGTGGG + Intronic
1140021359 16:71242018-71242040 ATATCTGTAAGCAGCTCATCAGG + Intergenic
1140790812 16:78389207-78389229 CTATCAAGAGGCACCTCAACAGG + Intronic
1141482853 16:84318403-84318425 CTTTCTGGAAGCAGCTGAGAAGG - Intronic
1141559260 16:84856095-84856117 CCTTCAGCAAGCACCTCAGCAGG + Intronic
1203048433 16_KI270728v1_random:854160-854182 CTGGCTGGGAACACCTCAGCTGG - Intergenic
1142587925 17:986233-986255 CTTTCAGTAAGCACCTCAGCTGG + Intergenic
1142630866 17:1225354-1225376 CTCTGAGGAAGCAACTCAGCTGG + Intronic
1143387855 17:6542753-6542775 CTGCCTGGAAGCCCCTCAGGTGG - Intronic
1143520084 17:7439896-7439918 CTTTCGGGGAGCCCCTCAGCCGG - Intronic
1146238300 17:31188164-31188186 CCTTCAGCAAGCACCTCAGCAGG - Intronic
1146255513 17:31389909-31389931 CTAGCTGGATGCCGCTCAGCAGG - Intergenic
1148635417 17:49145570-49145592 CCTTCAGCAAGCACCTCAGCAGG + Intronic
1149556389 17:57576348-57576370 CTATATGAAAGAATCTCAGCTGG - Intronic
1153089991 18:1332094-1332116 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1153131001 18:1855784-1855806 CTGTCAGCAAGCACCTCAGCAGG + Intergenic
1154252292 18:12754819-12754841 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1154272979 18:12936002-12936024 CCCTCAGCAAGCACCTCAGCTGG + Intergenic
1154505615 18:15037683-15037705 TCTTCAGGAAGCACCTCAGCTGG - Intergenic
1154506420 18:15044814-15044836 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1156435080 18:37118336-37118358 CCATCAGCAAGCACCTCAGCTGG + Intronic
1156537889 18:37881204-37881226 CCTTCAGTAAGCACCTCAGCAGG - Intergenic
1156998843 18:43499661-43499683 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1157846285 18:51006909-51006931 CTATCTGGAAGCACCTCAGCTGG - Intronic
1157870674 18:51227673-51227695 CCTTCAGCAAGCACCTCAGCTGG + Intergenic
1159151651 18:64530760-64530782 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1159850019 18:73516144-73516166 CCTTCAGGAAGCACCTCAGCAGG - Intergenic
1160092714 18:75841954-75841976 CCCTCAGCAAGCACCTCAGCAGG - Intergenic
1164209961 19:23090264-23090286 CCATCTGAGACCACCTCAGCTGG - Intronic
1165892123 19:39119525-39119547 CCACCTGGAAGCAACTCTGCTGG - Intergenic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
1166977590 19:46613808-46613830 CTTACTGGAAGCAGCTGAGCGGG + Intergenic
1168539060 19:57195472-57195494 CCTTCAGCAAGCACCTCAGCAGG + Intronic
925079448 2:1051744-1051766 CGATCTGGAAGCAGATCTGCTGG + Intronic
925105281 2:1285760-1285782 CCTTCAGCAAGCACCTCAGCAGG + Intronic
925280223 2:2678789-2678811 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
925461007 2:4062386-4062408 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
925499138 2:4484955-4484977 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
926827031 2:16915601-16915623 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
926883973 2:17579782-17579804 CTAACTGAAAGCACCACAGGAGG - Intronic
927008986 2:18881645-18881667 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
928335797 2:30396885-30396907 GGCTCTGGAAGCACCTCAGAGGG + Intergenic
930011319 2:46940708-46940730 CTCTCTGGACGCCCCTCTGCTGG - Intronic
930480903 2:51947327-51947349 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
930536355 2:52650309-52650331 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
931146966 2:59529792-59529814 CTATCTGCACGCTCCTCAGTTGG - Intergenic
931727857 2:65129011-65129033 CTATCTGCAAGCATCCAAGCAGG + Intronic
932870420 2:75393146-75393168 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
933117912 2:78497798-78497820 GTCTCTGGAGGCACATCAGCAGG - Intergenic
934167686 2:89309814-89309836 CTGTCTGGGAGCAGCTCTGCAGG - Intergenic
934199599 2:89872769-89872791 CTGTCTGGGAGCAGCTCTGCAGG + Intergenic
934306000 2:91822493-91822515 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
934327256 2:92030249-92030271 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
934465638 2:94260829-94260851 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
934871386 2:97869545-97869567 CTGTCAGGAAGGACATCAGCAGG + Intronic
935823457 2:106917095-106917117 CCTTCAGCAAGCACCTCAGCTGG - Intergenic
937435951 2:121881409-121881431 CCAGCTGGCAGCACCTCAGCAGG - Intergenic
937469368 2:122162224-122162246 CTCTCTGGAATCCCCTCAGGTGG - Intergenic
938504804 2:131867951-131867973 TCTTCAGGAAGCACCTCAGCTGG - Intergenic
940171049 2:150830761-150830783 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
940676765 2:156732848-156732870 ACTTCAGGAAGCACCTCAGCTGG - Intergenic
941337848 2:164267550-164267572 CCATCTGAGACCACCTCAGCTGG - Intergenic
941668298 2:168263031-168263053 CCCTCAGCAAGCACCTCAGCAGG - Intergenic
942988109 2:182165664-182165686 CCTTCAGTAAGCACCTCAGCTGG - Intronic
943021117 2:182575099-182575121 CTTTAAGCAAGCACCTCAGCAGG + Intergenic
943182545 2:184561580-184561602 CCTTCTGCAAGCACCTCAGCGGG - Intergenic
943330310 2:186550922-186550944 CTATATGGAGGGACTTCAGCTGG - Intergenic
943383806 2:187179153-187179175 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
943415148 2:187592079-187592101 CCATCTGAGACCACCTCAGCTGG + Intergenic
943509300 2:188803960-188803982 CCTTCAGTAAGCACCTCAGCAGG - Intergenic
943517318 2:188905284-188905306 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
945141223 2:206688515-206688537 CTATCTGGTTTGACCTCAGCTGG + Intronic
945725582 2:213469548-213469570 CCTTCAGCAAGCACCTCAGCAGG + Intronic
946527554 2:220537744-220537766 CCTTCAGGAAGCACCTCAGCAGG + Intergenic
946635739 2:221723870-221723892 CCATCTGAGACCACCTCAGCCGG - Intergenic
946637350 2:221744242-221744264 CAATCTGGGAGCAGCTCAGCTGG + Intergenic
948340188 2:237244434-237244456 CTTTCAGCAAGCACCTCAGCTGG + Intergenic
1168866285 20:1089801-1089823 CAATGTGTAAGCTCCTCAGCTGG + Intergenic
1168873998 20:1157733-1157755 CCTTCAGTAAGCACCTCAGCAGG + Intronic
1169332151 20:4724550-4724572 CGATGAGGAAGCACCTGAGCTGG + Exonic
1172615380 20:36279990-36280012 CTGTCAGGTAGGACCTCAGCTGG + Intergenic
1173111669 20:40196757-40196779 CTAGTTGGAAGCAGCTCAGCAGG + Intergenic
1173673796 20:44816232-44816254 CTAGCTGAAAGCCACTCAGCTGG - Intergenic
1174876875 20:54236204-54236226 GAATCTGGGAGCAGCTCAGCTGG + Intergenic
1176791435 21:13324209-13324231 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1176792245 21:13331435-13331457 TCTTCAGGAAGCACCTCAGCTGG + Intergenic
1176998431 21:15582189-15582211 CCATCAGCAAGCACCTCAGCAGG - Intergenic
1177139155 21:17340330-17340352 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1177505288 21:22012283-22012305 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1177990352 21:28029107-28029129 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1177991645 21:28042297-28042319 TCTTCAGGAAGCACCTCAGCTGG + Intergenic
1178634647 21:34291450-34291472 CCTTCAGCAAGCACCTCAGCTGG - Intergenic
1180279566 22:10681478-10681500 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1180586779 22:16900008-16900030 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1181373453 22:22437239-22437261 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1181839005 22:25638492-25638514 CCATCAGCAAGCACCTCAGTCGG + Intronic
1182965953 22:34521016-34521038 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
949246145 3:1926832-1926854 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
949417322 3:3828950-3828972 CCTTCAGCAAGCACCTCAGCAGG + Intronic
950169056 3:10823898-10823920 TTATCTGGAAGCACTTCAGAAGG + Intronic
950625004 3:14238832-14238854 CCCTCAGCAAGCACCTCAGCTGG - Intergenic
951384790 3:22029456-22029478 CCTTCAGCAAGCACCTCAGCAGG - Intronic
952444086 3:33363537-33363559 CCTTCAGCAAGCACCTCAGCTGG + Intronic
954511223 3:51127750-51127772 CCTTCAGCAAGCACCTCAGCAGG + Intronic
956264807 3:67384974-67384996 CTCTCTGGAAGAGTCTCAGCGGG + Intronic
957247300 3:77731970-77731992 CCTTCAGTAAGCACCTCAGCAGG + Intergenic
957873037 3:86112079-86112101 CCATCTGAGACCACCTCAGCCGG - Intergenic
958499658 3:94888829-94888851 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
959226517 3:103595341-103595363 CTTTAAGCAAGCACCTCAGCAGG + Intergenic
959602923 3:108209030-108209052 CCTTCAGTAAGCACCTCAGCTGG - Intronic
959745753 3:109775340-109775362 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
959998142 3:112700229-112700251 CTTTCAGCAAGCACCTCAGCAGG - Intergenic
961710708 3:128826081-128826103 CCTTCAGCAAGCACCTCAGCTGG + Intergenic
963331544 3:143921461-143921483 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
963355384 3:144204919-144204941 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
964146775 3:153473275-153473297 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
965291492 3:166887649-166887671 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
965958193 3:174396814-174396836 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
965995951 3:174883734-174883756 CCTTCAGCAAGCACCTCAGCAGG + Intronic
966044065 3:175528973-175528995 CCTTCAGCAAGCACCTCAGCAGG + Intronic
967832061 3:193927925-193927947 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
969178507 4:5419105-5419127 CTTGCTGGAGGCCCCTCAGCTGG - Intronic
969207653 4:5659333-5659355 CTTTCTGGGAGCATCTAAGCAGG + Intronic
969389251 4:6878630-6878652 CCTTCAGCAAGCACCTCAGCAGG + Intronic
970654248 4:18213571-18213593 CCATCAGGAAGCACCCCAGTTGG + Intergenic
971897781 4:32619340-32619362 CCTTCAGCAAGCACCTCAGCTGG - Intergenic
972095754 4:35344742-35344764 CTTTCAGCAAGCACCTCAGCAGG - Intergenic
972710324 4:41588891-41588913 CTATATGGAGGGACATCAGCTGG - Intronic
972806201 4:42531311-42531333 CCTTCAGCAAGCACCTCAGCAGG - Intronic
973103175 4:46296680-46296702 CCTTCAGCAAGCACCTCAGCAGG - Intronic
975363065 4:73494424-73494446 TCATCTTGAAGTACCTCAGCTGG - Intronic
975982346 4:80175336-80175358 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
976285417 4:83366332-83366354 CCATCTGGAAGCAGCTTAGGAGG + Intergenic
977031947 4:91894129-91894151 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
977431029 4:96930132-96930154 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
977505173 4:97893084-97893106 CTAACTGGAAGAAGCTAAGCAGG - Intronic
977832961 4:101615902-101615924 CCTTCAGCAAGCACCTCAGCAGG + Intronic
977898969 4:102396528-102396550 CCTTCAGCAAGCACCTCAGCAGG - Intronic
978771878 4:112465847-112465869 CTTTCAGCAAGCACCTCAGCAGG + Intergenic
978898793 4:113924900-113924922 CCCTCTGCAAGCACCTCAGCAGG + Intronic
979122452 4:116920622-116920644 CTATGTGGAAGCTCCTCATATGG - Intergenic
979721371 4:123904530-123904552 CCATCTGAGACCACCTCAGCTGG - Intergenic
980405633 4:132351854-132351876 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
980497370 4:133604134-133604156 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
980958059 4:139448249-139448271 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
981452634 4:144916286-144916308 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
982481921 4:155922454-155922476 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
983027669 4:162757222-162757244 CCATCAGCAAGCACCTCAGCAGG - Intergenic
983582963 4:169326787-169326809 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
983785237 4:171721695-171721717 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
985174653 4:187188283-187188305 CCTGCTGGCAGCACCTCAGCAGG - Intergenic
985632555 5:1021647-1021669 CTGTCTGGAAACCCCGCAGCCGG - Intronic
986147370 5:5091329-5091351 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
986261368 5:6150557-6150579 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
986308208 5:6531306-6531328 CTAAGTGGAAGAACCTAAGCTGG + Intergenic
986743213 5:10721688-10721710 CCTTCAGCAAGCACCTCAGCAGG - Intronic
987016632 5:13826991-13827013 TTATCTGAGACCACCTCAGCCGG - Intronic
987466363 5:18276426-18276448 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
987467982 5:18295423-18295445 CTTTCAGAAAGCACCTCAGCAGG + Intergenic
987650498 5:20734088-20734110 CTATCTGAGACTACCTCAGCCGG + Intergenic
987753467 5:22069938-22069960 CTGTCAGCAAGCAACTCAGCTGG - Intronic
988168952 5:27630911-27630933 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
988267499 5:28971436-28971458 CTTTCAGCAAGCACCTCAGCAGG + Intergenic
988685798 5:33524098-33524120 CTATCTGAAAGCATCACAGTGGG + Exonic
988745053 5:34127369-34127391 CTATCTGAGACTACCTCAGCCGG - Intergenic
988785261 5:34561018-34561040 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
989044879 5:37265344-37265366 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
989307236 5:39972683-39972705 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
989486114 5:41994452-41994474 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
990748062 5:58981703-58981725 CCCTCAGCAAGCACCTCAGCTGG + Intronic
990809734 5:59709478-59709500 CTATCTGGAAGCTTCTCAGCAGG - Intronic
993367074 5:87047927-87047949 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
993412315 5:87589859-87589881 CCTTCAGTAAGCACCTCAGCAGG + Intergenic
994217864 5:97159200-97159222 CTGTCTGTAGGCACCACAGCTGG + Intronic
994291105 5:98030020-98030042 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
994604972 5:101955528-101955550 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
995095592 5:108231987-108232009 CCTTCAGCAAGCACCTCAGCAGG - Intronic
995626277 5:114080025-114080047 CTATATGGAAGGACCTCTGGTGG + Intergenic
996825828 5:127679755-127679777 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
996905714 5:128597295-128597317 CCCTCTGCTAGCACCTCAGCTGG + Intronic
997665310 5:135625702-135625724 CTACCTGGGGGCACCTCAGAAGG - Intergenic
998038489 5:138936189-138936211 GAATCTGGGAGCAGCTCAGCTGG + Intergenic
998290062 5:140906618-140906640 CCTTCAGCAAGCACCTCAGCAGG + Intronic
1000417280 5:160996139-160996161 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1001396102 5:171420419-171420441 GTACCTGGAAGCACAGCAGCAGG - Exonic
1001587626 5:172844234-172844256 CTATCAGCAAGTACCTCAGTCGG + Intronic
1002950863 6:1810058-1810080 CTATGTGGTAGCCCCTGAGCCGG + Intronic
1003615113 6:7648144-7648166 CTTTCTGGAAGCTCCACATCTGG + Intergenic
1004505437 6:16243351-16243373 CTCTCTGGTAGCACTGCAGCTGG + Intronic
1004541185 6:16551767-16551789 CCAGCTGGAAGCGCCACAGCAGG - Intronic
1005185434 6:23158999-23159021 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1005543176 6:26835116-26835138 CTATCTGAGACTACCTCAGCCGG - Intergenic
1005697575 6:28365461-28365483 TTTTCTGGAAGCTCCTCAGCTGG - Exonic
1006062606 6:31435134-31435156 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1008079112 6:47176637-47176659 CTTTCAGCAAGCACCTCAGCAGG + Intergenic
1008400535 6:51057370-51057392 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1009014000 6:57877283-57877305 CTATCTGAGACTACCTCAGCCGG - Intergenic
1009389861 6:63133138-63133160 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1010406757 6:75514963-75514985 CTTTCAGCAGGCACCTCAGCTGG + Intergenic
1010552424 6:77238803-77238825 CCTTCAGCAAGCACCTCAGCCGG - Intergenic
1010580548 6:77592315-77592337 CTTTCAGCAAGCACCTCAGCAGG + Intergenic
1010853872 6:80813594-80813616 CCTTCAGCAAGCACCTCAGCTGG + Intergenic
1011039089 6:83011370-83011392 CCTTCAGCAAGCACCTCAGCAGG + Intronic
1012002192 6:93666843-93666865 CTTTCAGCAAGCACCTCAGCTGG - Intergenic
1012730696 6:102876215-102876237 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1013098581 6:106968390-106968412 CTGTCAGTAAGCATCTCAGCTGG - Intergenic
1013406935 6:109851676-109851698 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1013947153 6:115735356-115735378 CCATCTGAGACCACCTCAGCTGG - Intergenic
1014414966 6:121172566-121172588 CCTTCAGCAAGCACCTCAGCAGG - Intronic
1015095174 6:129407669-129407691 CCTTCTGCAAGCACCTCAGCGGG + Intronic
1015803615 6:137086506-137086528 ATATCTGGAAGCCCAACAGCAGG - Intergenic
1015918048 6:138238200-138238222 CTATCTAGAATCAACTCAGGTGG - Intronic
1016119678 6:140330747-140330769 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1016576000 6:145570648-145570670 CCTTCAGCAAGCACCTCAGCAGG + Intronic
1017691295 6:156968122-156968144 GCATCTGTAAGCACCTCACCTGG + Intronic
1018425521 6:163676810-163676832 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1018534762 6:164808471-164808493 CCTTCTGCAAGCACCTCAGGGGG + Intergenic
1018600154 6:165529468-165529490 CCTTCAGCAAGCACCTCAGCAGG - Intronic
1020567506 7:9816910-9816932 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1020870913 7:13627954-13627976 CCTTCAGAAAGCACCTCAGCTGG + Intergenic
1021112479 7:16710899-16710921 GAATCTGGAAGCAGCTAAGCAGG + Intergenic
1022038653 7:26558412-26558434 CCATCTGGAAGGTCCTCTGCAGG + Intergenic
1024040816 7:45552085-45552107 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1024610649 7:51061088-51061110 CCTTCAGCAAGCACCTCAGCTGG - Intronic
1024953170 7:54886671-54886693 CTATCTGGGAGCAGCTCTTCAGG + Intergenic
1026735239 7:72945089-72945111 CTCTCTGGCAGCCCCTCTGCAGG - Intronic
1026785581 7:73300018-73300040 CTCTCTGGCAGCCCCTCTGCAGG - Intergenic
1027108485 7:75419918-75419940 CTCTCTGGCAGCCCCTCTGCAGG + Intronic
1027253863 7:76417416-76417438 TTAGCTGGAAGGACCTCAGTGGG - Intronic
1030355686 7:108539463-108539485 CTTTCAGCAAGCACCTCAGCAGG - Intronic
1030506955 7:110436614-110436636 CCTTCAGCAAGCACCTCAGCTGG - Intergenic
1030579288 7:111333112-111333134 CCTTCAGCAAGCACCTCAGCAGG - Intronic
1031474187 7:122203419-122203441 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1031682273 7:124689188-124689210 CTTTCAGCAAGCACTTCAGCTGG - Intergenic
1033135395 7:138779997-138780019 CCTTCAGCAAGCACCTCAGCTGG + Intronic
1034967421 7:155399927-155399949 CTATCTAGAAGCACCAGAGCTGG - Intergenic
1035577766 8:719024-719046 CTATGGGGAAGCTCCTCAGGAGG - Intronic
1037358941 8:18053317-18053339 CAATTTGGAGGCATCTCAGCTGG - Intergenic
1037675456 8:21047265-21047287 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1037865458 8:22439536-22439558 TCATCTGGAAGAACCTCAACAGG - Intergenic
1040912198 8:52530349-52530371 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1041019770 8:53627093-53627115 CTGTCTGGAAGCAGCTCTGAGGG + Intergenic
1041935568 8:63327935-63327957 CCTTCAGGAAGCACATCAGCAGG - Intergenic
1044285702 8:90410514-90410536 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1046128381 8:109939436-109939458 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1046255792 8:111694655-111694677 CCCTCTGGAAGCTCCTGAGCGGG + Intergenic
1047153854 8:122295195-122295217 CCATCTGAGATCACCTCAGCTGG + Intergenic
1049538790 8:143196067-143196089 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1050727238 9:8664609-8664631 CTATCTGGAAGTATATGAGCTGG - Intronic
1050888515 9:10794827-10794849 CCTTCAGGAAGCACCTCAGGTGG + Intergenic
1050902101 9:10961850-10961872 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1051306121 9:15711897-15711919 CTGTCAGCAAGCATCTCAGCTGG + Intronic
1052201526 9:25787373-25787395 CAATCTGGAAGCTTCTCTGCAGG - Intergenic
1052227851 9:26110316-26110338 CCTTCAGCAAGCACCTCAGCAGG - Intronic
1053695702 9:40637609-40637631 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1053942692 9:43268652-43268674 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1054306949 9:63436827-63436849 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1054460383 9:65459162-65459184 CTATCTGGATGACCATCAGCAGG + Intergenic
1055103368 9:72487647-72487669 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1055742445 9:79404692-79404714 GTCTCAGGAAGCACCTCAGGAGG - Intergenic
1055903669 9:81269254-81269276 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1056313975 9:85370998-85371020 CTGTCAGCAAGCACCTCAGCAGG + Intergenic
1056761156 9:89415832-89415854 CATTCTGGAAGCATCTCTGCTGG - Intronic
1056996491 9:91466337-91466359 TTCTCAGGAAGCATCTCAGCTGG - Intergenic
1058020167 9:100077991-100078013 CTTTCAGCAAGCACCTCAGCAGG - Intronic
1059592697 9:115679172-115679194 CATTCAGCAAGCACCTCAGCTGG - Intergenic
1061311649 9:129767527-129767549 CCTTCAGCAAGCACCTCAGCTGG + Intergenic
1061358536 9:130124762-130124784 CTATCTGGAATCAAGTCCGCTGG - Intronic
1061894743 9:133641374-133641396 CCCTCTGGAAGCACCTCACAGGG + Intronic
1062214524 9:135382113-135382135 GTATCTGGGAGTGCCTCAGCAGG + Intergenic
1062573915 9:137197841-137197863 CCCACTGGAAGCACCTCAGGAGG + Intronic
1202778147 9_KI270717v1_random:11221-11243 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1187372592 X:18722897-18722919 CTAACTGCATGCACCTCAGTTGG + Intronic
1188997518 X:36904286-36904308 CCATCTGAGACCACCTCAGCTGG - Intergenic
1189025026 X:37385628-37385650 CAATCTAGGAGCAACTCAGCTGG + Intronic
1189105574 X:38231848-38231870 CCCTCAGCAAGCACCTCAGCTGG - Intronic
1189596666 X:42573613-42573635 CTTTCAGCAAGCACCTCAGCTGG - Intergenic
1190765961 X:53475846-53475868 CCTTCAGCAAGCACCTCAGCTGG - Intergenic
1191769243 X:64738157-64738179 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1191933169 X:66396084-66396106 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1192341439 X:70266996-70267018 CTATCTGAAAGCCCCTGAGAAGG + Intergenic
1192891215 X:75392906-75392928 CCTTCAGGAAGCACTTCAGCAGG + Intronic
1192996438 X:76517541-76517563 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1193053761 X:77127698-77127720 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1193356498 X:80525090-80525112 CTTTCAGCAAGCACCTCAACAGG - Intergenic
1193573454 X:83173247-83173269 CCTTCAGGAGGCACCTCAGCAGG + Intergenic
1193833216 X:86312041-86312063 CCTTCAGCAAGCACCTCAGCAGG - Intronic
1193841292 X:86411833-86411855 CCTTCAGCAAGCACCTCAGCAGG + Intronic
1193904721 X:87227760-87227782 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1193914554 X:87350028-87350050 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1193979144 X:88159349-88159371 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1194174890 X:90632764-90632786 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1194210547 X:91064290-91064312 CTTTCAGCAAGCACCTCAGCAGG - Intergenic
1194277162 X:91899933-91899955 CCTTCAGCAAGCACCTCAGCAGG + Intronic
1194584376 X:95714985-95715007 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1194848979 X:98850234-98850256 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1195809527 X:108814880-108814902 CTTTCAGTAAGCACCTCAGCAGG + Intergenic
1195932223 X:110090069-110090091 CTATCTGGAAGGTACTCAACTGG - Intronic
1196275890 X:113764607-113764629 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1197074179 X:122335923-122335945 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1197182371 X:123549716-123549738 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1197273239 X:124448902-124448924 CAGTCTGGAAGTACCTCTGCTGG - Intronic
1197409082 X:126094506-126094528 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1197592136 X:128421324-128421346 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1198623014 X:138534545-138534567 CTAGCTGCTACCACCTCAGCTGG + Intergenic
1198701565 X:139402223-139402245 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1198782789 X:140255873-140255895 CCTTCAGCAAGCACCTCAGCAGG + Intergenic
1199024637 X:142921666-142921688 CTTTCAGTAAGCACCTCAGCTGG - Intergenic
1200019628 X:153190996-153191018 CCCTCAGCAAGCACCTCAGCTGG - Intergenic
1200521540 Y:4213954-4213976 CCTTCAGCAAGCACCTCAGCAGG - Intergenic
1200594506 Y:5122032-5122054 CCTTCAGCAAGCACCTCAGCAGG + Intronic
1200852976 Y:7904560-7904582 CTATCTGCAGGGACCTCAGAAGG - Intergenic
1202134364 Y:21646466-21646488 CCTTCAGCAAGCACCTCAGCAGG + Intergenic