ID: 1157849026

View in Genome Browser
Species Human (GRCh38)
Location 18:51030419-51030441
Sequence CCCGGGCCGCCCTGCGGCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 319}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157849026_1157849041 15 Left 1157849026 18:51030419-51030441 CCCCCGCCGCAGGGCGGCCCGGG 0: 1
1: 0
2: 4
3: 27
4: 319
Right 1157849041 18:51030457-51030479 GGCCCGCGCGGGCAGCGGCGCGG 0: 1
1: 0
2: 1
3: 60
4: 463
1157849026_1157849039 10 Left 1157849026 18:51030419-51030441 CCCCCGCCGCAGGGCGGCCCGGG 0: 1
1: 0
2: 4
3: 27
4: 319
Right 1157849039 18:51030452-51030474 GGTCCGGCCCGCGCGGGCAGCGG 0: 1
1: 0
2: 0
3: 15
4: 164
1157849026_1157849045 26 Left 1157849026 18:51030419-51030441 CCCCCGCCGCAGGGCGGCCCGGG 0: 1
1: 0
2: 4
3: 27
4: 319
Right 1157849045 18:51030468-51030490 GCAGCGGCGCGGCGCTGAGGAGG 0: 1
1: 0
2: 1
3: 134
4: 288
1157849026_1157849038 4 Left 1157849026 18:51030419-51030441 CCCCCGCCGCAGGGCGGCCCGGG 0: 1
1: 0
2: 4
3: 27
4: 319
Right 1157849038 18:51030446-51030468 CGAGGCGGTCCGGCCCGCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 99
1157849026_1157849035 -6 Left 1157849026 18:51030419-51030441 CCCCCGCCGCAGGGCGGCCCGGG 0: 1
1: 0
2: 4
3: 27
4: 319
Right 1157849035 18:51030436-51030458 CCCGGGAGCTCGAGGCGGTCCGG 0: 1
1: 0
2: 1
3: 10
4: 134
1157849026_1157849037 3 Left 1157849026 18:51030419-51030441 CCCCCGCCGCAGGGCGGCCCGGG 0: 1
1: 0
2: 4
3: 27
4: 319
Right 1157849037 18:51030445-51030467 TCGAGGCGGTCCGGCCCGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 39
1157849026_1157849044 23 Left 1157849026 18:51030419-51030441 CCCCCGCCGCAGGGCGGCCCGGG 0: 1
1: 0
2: 4
3: 27
4: 319
Right 1157849044 18:51030465-51030487 CGGGCAGCGGCGCGGCGCTGAGG 0: 1
1: 0
2: 4
3: 42
4: 337
1157849026_1157849047 28 Left 1157849026 18:51030419-51030441 CCCCCGCCGCAGGGCGGCCCGGG 0: 1
1: 0
2: 4
3: 27
4: 319
Right 1157849047 18:51030470-51030492 AGCGGCGCGGCGCTGAGGAGGGG 0: 1
1: 0
2: 1
3: 13
4: 154
1157849026_1157849046 27 Left 1157849026 18:51030419-51030441 CCCCCGCCGCAGGGCGGCCCGGG 0: 1
1: 0
2: 4
3: 27
4: 319
Right 1157849046 18:51030469-51030491 CAGCGGCGCGGCGCTGAGGAGGG 0: 1
1: 0
2: 1
3: 3
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157849026 Original CRISPR CCCGGGCCGCCCTGCGGCGG GGG (reversed) Exonic