ID: 1157849129

View in Genome Browser
Species Human (GRCh38)
Location 18:51030698-51030720
Sequence CGGGCTCCCGACGACGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157849112_1157849129 5 Left 1157849112 18:51030670-51030692 CCCCGCCTGTGGCTTCCCCGCCC 0: 1
1: 0
2: 1
3: 23
4: 321
Right 1157849129 18:51030698-51030720 CGGGCTCCCGACGACGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 85
1157849111_1157849129 12 Left 1157849111 18:51030663-51030685 CCGCGCACCCCGCCTGTGGCTTC 0: 1
1: 0
2: 1
3: 31
4: 186
Right 1157849129 18:51030698-51030720 CGGGCTCCCGACGACGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 85
1157849121_1157849129 -10 Left 1157849121 18:51030685-51030707 CCCCGCCCCGGGGCGGGCTCCCG 0: 1
1: 0
2: 5
3: 37
4: 329
Right 1157849129 18:51030698-51030720 CGGGCTCCCGACGACGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 85
1157849106_1157849129 23 Left 1157849106 18:51030652-51030674 CCCGGCCGGGCCCGCGCACCCCG 0: 1
1: 0
2: 6
3: 78
4: 504
Right 1157849129 18:51030698-51030720 CGGGCTCCCGACGACGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 85
1157849110_1157849129 13 Left 1157849110 18:51030662-51030684 CCCGCGCACCCCGCCTGTGGCTT 0: 1
1: 0
2: 1
3: 42
4: 436
Right 1157849129 18:51030698-51030720 CGGGCTCCCGACGACGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 85
1157849102_1157849129 30 Left 1157849102 18:51030645-51030667 CCCTTCCCCCGGCCGGGCCCGCG 0: 1
1: 0
2: 7
3: 25
4: 267
Right 1157849129 18:51030698-51030720 CGGGCTCCCGACGACGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 85
1157849104_1157849129 25 Left 1157849104 18:51030650-51030672 CCCCCGGCCGGGCCCGCGCACCC 0: 1
1: 0
2: 4
3: 79
4: 496
Right 1157849129 18:51030698-51030720 CGGGCTCCCGACGACGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 85
1157849107_1157849129 22 Left 1157849107 18:51030653-51030675 CCGGCCGGGCCCGCGCACCCCGC 0: 1
1: 0
2: 8
3: 88
4: 627
Right 1157849129 18:51030698-51030720 CGGGCTCCCGACGACGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 85
1157849117_1157849129 0 Left 1157849117 18:51030675-51030697 CCTGTGGCTTCCCCGCCCCGGGG 0: 1
1: 0
2: 3
3: 23
4: 232
Right 1157849129 18:51030698-51030720 CGGGCTCCCGACGACGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 85
1157849105_1157849129 24 Left 1157849105 18:51030651-51030673 CCCCGGCCGGGCCCGCGCACCCC 0: 1
1: 0
2: 10
3: 82
4: 539
Right 1157849129 18:51030698-51030720 CGGGCTCCCGACGACGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 85
1157849113_1157849129 4 Left 1157849113 18:51030671-51030693 CCCGCCTGTGGCTTCCCCGCCCC 0: 1
1: 0
2: 4
3: 40
4: 481
Right 1157849129 18:51030698-51030720 CGGGCTCCCGACGACGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 85
1157849114_1157849129 3 Left 1157849114 18:51030672-51030694 CCGCCTGTGGCTTCCCCGCCCCG 0: 1
1: 0
2: 2
3: 19
4: 279
Right 1157849129 18:51030698-51030720 CGGGCTCCCGACGACGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 85
1157849108_1157849129 18 Left 1157849108 18:51030657-51030679 CCGGGCCCGCGCACCCCGCCTGT 0: 1
1: 0
2: 1
3: 16
4: 235
Right 1157849129 18:51030698-51030720 CGGGCTCCCGACGACGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 85
1157849103_1157849129 29 Left 1157849103 18:51030646-51030668 CCTTCCCCCGGCCGGGCCCGCGC 0: 1
1: 0
2: 7
3: 105
4: 624
Right 1157849129 18:51030698-51030720 CGGGCTCCCGACGACGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157849129 Original CRISPR CGGGCTCCCGACGACGGCGG CGG Intronic
900411360 1:2514163-2514185 CGGGCTCCTGAGGACGTCCGTGG - Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
901934526 1:12618384-12618406 CGCGCTCCCCGCGACGGCGCAGG - Intergenic
903263575 1:22143523-22143545 TGGGCTCCAGGCGCCGGCGGGGG - Intronic
904181446 1:28669116-28669138 CGGGCCCCAGACCAGGGCGGCGG + Intronic
914255300 1:145957706-145957728 CGGGCTGCCGGCGGCGCCGGGGG + Exonic
1065342891 10:24723395-24723417 CGGGCGCCCGGCGGGGGCGGAGG - Intronic
1065727258 10:28677852-28677874 GGGGCTCCGGAAGCCGGCGGGGG + Exonic
1066135912 10:32446151-32446173 CGGGCACCCGCCGCCGGCGCCGG - Exonic
1071695458 10:87864170-87864192 CGGGCTCCGGAGGCCGCCGGCGG + Exonic
1073251028 10:102120417-102120439 GGGGCGCTCGGCGACGGCGGCGG - Exonic
1080503669 11:32892854-32892876 GGGACTCGCGGCGACGGCGGCGG - Intergenic
1089499906 11:118925777-118925799 CTGGCTCCGGGCGGCGGCGGTGG + Intronic
1097057425 12:56258295-56258317 CGAGCTCCCGGCGGCGGCGGCGG + Exonic
1106533462 13:30617455-30617477 AGGGCTTCCGAAGCCGGCGGGGG - Intronic
1112507144 13:99981952-99981974 CGGGCTCCAGGCGCAGGCGGCGG - Exonic
1113798529 13:113074570-113074592 CGGGGTCCCGGCGGGGGCGGCGG + Intronic
1114514047 14:23286065-23286087 CGCGCTCCCGGGGACGGTGGGGG - Exonic
1122418584 14:101561715-101561737 CGGGCTGCCCCCGGCGGCGGCGG - Exonic
1122736755 14:103847757-103847779 CGCGCTCCCGGCGGCGGGGGAGG + Intergenic
1135821885 16:25692387-25692409 CCGGCTCGCGGCGGCGGCGGCGG - Exonic
1139917813 16:70439040-70439062 ACGGGTCCGGACGACGGCGGCGG - Intronic
1141989648 16:87602681-87602703 CGGGCGCCCGAGGGCGGCGGCGG - Intronic
1144737191 17:17561755-17561777 CGGGCTCCCGAGGATGGCAAGGG + Intronic
1150268827 17:63849447-63849469 CGGGCTTCCGGCGACGGCCAAGG - Intergenic
1155392491 18:25351139-25351161 CGCGCTCTGCACGACGGCGGCGG + Intronic
1156099640 18:33578397-33578419 GGGGCGCGCGACGGCGGCGGCGG - Intergenic
1156446951 18:37243966-37243988 CTGGCTGCCGACGCCGGTGGAGG - Exonic
1157849129 18:51030698-51030720 CGGGCTCCCGACGACGGCGGCGG + Intronic
1160719127 19:589885-589907 CGGGCTCCGGCCGGCGGCGGCGG + Exonic
1162312434 19:9914854-9914876 CGGGCTGAGGGCGACGGCGGCGG - Intronic
1162760493 19:12885781-12885803 CGGGCTCCCGACGCCTTCGTGGG - Exonic
1166982411 19:46639182-46639204 TGGGGACCCGACGACGGAGGCGG + Intergenic
1167072954 19:47231151-47231173 CGGGCGCCTGGCGGCGGCGGCGG - Intronic
1168277781 19:55286719-55286741 CGGGCTCCCCAGGACGGAGAGGG + Intronic
1168718987 19:58544642-58544664 CGGCCTCGCGGCGGCGGCGGCGG + Exonic
926095717 2:10079906-10079928 CGCGCTCCCCGCGACCGCGGTGG + Exonic
926128646 2:10286715-10286737 AGGGCTCCCGTCGGGGGCGGGGG - Intergenic
931516208 2:63051874-63051896 CGGGTTCCCGGCAGCGGCGGGGG + Intronic
942240806 2:173963717-173963739 CGGGCGCCCGGCCTCGGCGGGGG + Intronic
946322084 2:218960145-218960167 CGGGATCCCCCCGACGGCGGCGG + Exonic
947418487 2:229921713-229921735 CCTGCTCCCGGCGCCGGCGGCGG - Intronic
947506786 2:230713445-230713467 CGGGCGCCCCACGCCGGCGAAGG - Intronic
1169191335 20:3660721-3660743 CGGGATCCGGGCGAGGGCGGGGG - Intronic
1176414687 21:6467722-6467744 CGGGGTCCCGGGGAGGGCGGGGG - Intergenic
1179690187 21:43076044-43076066 CGGGGTCCCGGGGAGGGCGGGGG - Intronic
1180421095 22:12815569-12815591 CGGGCTGCCGACCCTGGCGGGGG - Intergenic
1182031699 22:27164051-27164073 CGGGCTGCCGATGACGGATGGGG - Intergenic
950729887 3:14947929-14947951 CGGGCTCGGGCCGGCGGCGGAGG + Intronic
951803540 3:26623048-26623070 TTGGCTCCCGGCGAAGGCGGCGG - Exonic
955387615 3:58492070-58492092 CCCGCGCCCGGCGACGGCGGCGG - Intergenic
962520867 3:136196300-136196322 AGCGCTAGCGACGACGGCGGCGG - Intronic
965590623 3:170357584-170357606 CGGGCGGCCGGAGACGGCGGCGG + Intergenic
965590652 3:170357729-170357751 CGGGCGAGCGGCGACGGCGGCGG + Intronic
968434126 4:576248-576270 CGGGGTCGCGGCGGCGGCGGCGG - Intergenic
969720883 4:8892606-8892628 CGGGTTCCCGAGAGCGGCGGGGG + Intergenic
975778960 4:77819605-77819627 CGGGGTCCGGGCGGCGGCGGCGG + Intronic
975870759 4:78776325-78776347 CCGGCTCCCGCAGAGGGCGGTGG - Intronic
978617927 4:110614361-110614383 GGGAGTCCCGGCGACGGCGGCGG + Intergenic
985652071 5:1111939-1111961 GAGGCTCACGCCGACGGCGGCGG - Exonic
992312093 5:75511447-75511469 AGGGGTCACGGCGACGGCGGCGG - Exonic
992732790 5:79689768-79689790 CGGGTTCCCGGCGCCGGGGGCGG - Intergenic
994197523 5:96936280-96936302 CGGGCTTCCCACGAGGGCTGAGG + Intronic
994367110 5:98928815-98928837 CGCGCGCGCGACGGCGGCGGCGG - Exonic
998130411 5:139648796-139648818 CGGCCTCGCGGCGACGGCGGCGG + Exonic
999365485 5:151020886-151020908 CGGGGTCCCGGCGGCGGAGGGGG - Intronic
1006013212 6:31059590-31059612 AGGGCTCCAGACTAGGGCGGAGG - Intergenic
1007644401 6:43369304-43369326 CGGCCTAAAGACGACGGCGGGGG - Exonic
1016949535 6:149566508-149566530 GGGGCTCCGGACAGCGGCGGCGG - Exonic
1017446349 6:154510341-154510363 CGGGATCCCGGCGGCGGCGGGGG - Exonic
1017671989 6:156777771-156777793 CGGGCTCCGGGCGCCGGCCGCGG - Intergenic
1020238642 7:6375054-6375076 AGCGCTCCCGAGGAGGGCGGCGG - Intronic
1027236736 7:76302888-76302910 GGGGCTCTCGATGGCGGCGGGGG - Exonic
1030884627 7:114922511-114922533 CGGTGGCCTGACGACGGCGGCGG - Exonic
1032011827 7:128352098-128352120 GGCGCTCCCGAGGGCGGCGGCGG + Exonic
1033033216 7:137846764-137846786 CGGGCTGGCGGCGGCGGCGGCGG + Exonic
1033299937 7:140176670-140176692 CGGGCGGCCGGCGGCGGCGGCGG + Intronic
1043388242 8:79768278-79768300 CGGGCGGCCGGCGACGGCGACGG + Intergenic
1045564364 8:103298795-103298817 CGGGCTCGCGGCGGCGGCGGCGG - Intronic
1049549679 8:143251286-143251308 CGGCCTTCCGACGTGGGCGGTGG + Exonic
1051591001 9:18776893-18776915 CCTGCTCCCCAAGACGGCGGTGG + Exonic
1052824897 9:33167377-33167399 CGGGGCCCCGGCGAAGGCGGGGG + Intergenic
1053312333 9:37027610-37027632 AGGGCTAGCGACGGCGGCGGCGG - Intronic
1057060965 9:92003737-92003759 AGGGCTCCCTACGAGGGAGGCGG - Intergenic
1057245481 9:93451532-93451554 GGGGCTCCCGGAGGCGGCGGCGG - Intronic
1061170128 9:128947707-128947729 CGGGCGCGCGAAGATGGCGGCGG + Exonic
1061457981 9:130712977-130712999 CGGGCTCCGGACGTCGCCGTGGG + Intergenic
1061559675 9:131394348-131394370 CGGGCCCCCGGCGGCGGCCGCGG - Intronic
1062467120 9:136686413-136686435 TGGGCTGCCAAAGACGGCGGGGG - Intronic
1187915533 X:24149760-24149782 CGGGCGGCCGGCGACGGTGGCGG - Exonic
1190330843 X:49234325-49234347 GGGGCTCTCGACCGCGGCGGGGG + Intergenic
1198370632 X:135985623-135985645 GGGGCTTCGGACGGCGGCGGCGG + Exonic
1198683349 X:139204323-139204345 CGGGATCGCGGCGGCGGCGGCGG - Intronic