ID: 1157856173

View in Genome Browser
Species Human (GRCh38)
Location 18:51107569-51107591
Sequence TGCCCACCATACCACCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157856172_1157856173 -9 Left 1157856172 18:51107555-51107577 CCATCTTAGAATTCTGCCCACCA No data
Right 1157856173 18:51107569-51107591 TGCCCACCATACCACCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157856173 Original CRISPR TGCCCACCATACCACCAAAG AGG Intergenic
No off target data available for this crispr