ID: 1157856442

View in Genome Browser
Species Human (GRCh38)
Location 18:51109537-51109559
Sequence GGTGCGAAATATTCCACCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157856437_1157856442 10 Left 1157856437 18:51109504-51109526 CCAAAGGACTACTCAGACAGGAG No data
Right 1157856442 18:51109537-51109559 GGTGCGAAATATTCCACCGTGGG No data
1157856435_1157856442 14 Left 1157856435 18:51109500-51109522 CCAACCAAAGGACTACTCAGACA No data
Right 1157856442 18:51109537-51109559 GGTGCGAAATATTCCACCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157856442 Original CRISPR GGTGCGAAATATTCCACCGT GGG Intergenic
No off target data available for this crispr