ID: 1157858441

View in Genome Browser
Species Human (GRCh38)
Location 18:51121392-51121414
Sequence GCCCACTCTGGTGGCACTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157858441_1157858446 -7 Left 1157858441 18:51121392-51121414 CCTCAAGTGCCACCAGAGTGGGC No data
Right 1157858446 18:51121408-51121430 AGTGGGCGCCCAGGCAGAGGAGG No data
1157858441_1157858453 21 Left 1157858441 18:51121392-51121414 CCTCAAGTGCCACCAGAGTGGGC No data
Right 1157858453 18:51121436-51121458 AGTGTGAGCGAGGGCTGCGAGGG No data
1157858441_1157858452 20 Left 1157858441 18:51121392-51121414 CCTCAAGTGCCACCAGAGTGGGC No data
Right 1157858452 18:51121435-51121457 AAGTGTGAGCGAGGGCTGCGAGG No data
1157858441_1157858450 12 Left 1157858441 18:51121392-51121414 CCTCAAGTGCCACCAGAGTGGGC No data
Right 1157858450 18:51121427-51121449 GAGGCACCAAGTGTGAGCGAGGG No data
1157858441_1157858445 -10 Left 1157858441 18:51121392-51121414 CCTCAAGTGCCACCAGAGTGGGC No data
Right 1157858445 18:51121405-51121427 CAGAGTGGGCGCCCAGGCAGAGG No data
1157858441_1157858449 11 Left 1157858441 18:51121392-51121414 CCTCAAGTGCCACCAGAGTGGGC No data
Right 1157858449 18:51121426-51121448 GGAGGCACCAAGTGTGAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157858441 Original CRISPR GCCCACTCTGGTGGCACTTG AGG (reversed) Intergenic
No off target data available for this crispr