ID: 1157858444

View in Genome Browser
Species Human (GRCh38)
Location 18:51121404-51121426
Sequence CTCTGCCTGGGCGCCCACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157858444_1157858453 9 Left 1157858444 18:51121404-51121426 CCAGAGTGGGCGCCCAGGCAGAG No data
Right 1157858453 18:51121436-51121458 AGTGTGAGCGAGGGCTGCGAGGG No data
1157858444_1157858449 -1 Left 1157858444 18:51121404-51121426 CCAGAGTGGGCGCCCAGGCAGAG No data
Right 1157858449 18:51121426-51121448 GGAGGCACCAAGTGTGAGCGAGG No data
1157858444_1157858452 8 Left 1157858444 18:51121404-51121426 CCAGAGTGGGCGCCCAGGCAGAG No data
Right 1157858452 18:51121435-51121457 AAGTGTGAGCGAGGGCTGCGAGG No data
1157858444_1157858450 0 Left 1157858444 18:51121404-51121426 CCAGAGTGGGCGCCCAGGCAGAG No data
Right 1157858450 18:51121427-51121449 GAGGCACCAAGTGTGAGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157858444 Original CRISPR CTCTGCCTGGGCGCCCACTC TGG (reversed) Intergenic
No off target data available for this crispr