ID: 1157858450

View in Genome Browser
Species Human (GRCh38)
Location 18:51121427-51121449
Sequence GAGGCACCAAGTGTGAGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157858444_1157858450 0 Left 1157858444 18:51121404-51121426 CCAGAGTGGGCGCCCAGGCAGAG No data
Right 1157858450 18:51121427-51121449 GAGGCACCAAGTGTGAGCGAGGG No data
1157858441_1157858450 12 Left 1157858441 18:51121392-51121414 CCTCAAGTGCCACCAGAGTGGGC No data
Right 1157858450 18:51121427-51121449 GAGGCACCAAGTGTGAGCGAGGG No data
1157858443_1157858450 3 Left 1157858443 18:51121401-51121423 CCACCAGAGTGGGCGCCCAGGCA No data
Right 1157858450 18:51121427-51121449 GAGGCACCAAGTGTGAGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157858450 Original CRISPR GAGGCACCAAGTGTGAGCGA GGG Intergenic
No off target data available for this crispr