ID: 1157858453

View in Genome Browser
Species Human (GRCh38)
Location 18:51121436-51121458
Sequence AGTGTGAGCGAGGGCTGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157858443_1157858453 12 Left 1157858443 18:51121401-51121423 CCACCAGAGTGGGCGCCCAGGCA No data
Right 1157858453 18:51121436-51121458 AGTGTGAGCGAGGGCTGCGAGGG No data
1157858448_1157858453 -4 Left 1157858448 18:51121417-51121439 CCAGGCAGAGGAGGCACCAAGTG No data
Right 1157858453 18:51121436-51121458 AGTGTGAGCGAGGGCTGCGAGGG No data
1157858441_1157858453 21 Left 1157858441 18:51121392-51121414 CCTCAAGTGCCACCAGAGTGGGC No data
Right 1157858453 18:51121436-51121458 AGTGTGAGCGAGGGCTGCGAGGG No data
1157858444_1157858453 9 Left 1157858444 18:51121404-51121426 CCAGAGTGGGCGCCCAGGCAGAG No data
Right 1157858453 18:51121436-51121458 AGTGTGAGCGAGGGCTGCGAGGG No data
1157858447_1157858453 -3 Left 1157858447 18:51121416-51121438 CCCAGGCAGAGGAGGCACCAAGT No data
Right 1157858453 18:51121436-51121458 AGTGTGAGCGAGGGCTGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157858453 Original CRISPR AGTGTGAGCGAGGGCTGCGA GGG Intergenic
No off target data available for this crispr