ID: 1157860050

View in Genome Browser
Species Human (GRCh38)
Location 18:51133164-51133186
Sequence CTCAGTTTCCCCATGGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157860044_1157860050 16 Left 1157860044 18:51133125-51133147 CCAGGTCCTTGTATTTGGTGGAT No data
Right 1157860050 18:51133164-51133186 CTCAGTTTCCCCATGGGAGCTGG No data
1157860046_1157860050 10 Left 1157860046 18:51133131-51133153 CCTTGTATTTGGTGGATGGCAAC No data
Right 1157860050 18:51133164-51133186 CTCAGTTTCCCCATGGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157860050 Original CRISPR CTCAGTTTCCCCATGGGAGC TGG Intergenic
No off target data available for this crispr