ID: 1157862615

View in Genome Browser
Species Human (GRCh38)
Location 18:51154352-51154374
Sequence GCTCAGTCCAGGGGGCTCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157862615_1157862624 18 Left 1157862615 18:51154352-51154374 CCTGCGAGCCCCCTGGACTGAGC No data
Right 1157862624 18:51154393-51154415 GCAGCTGTTGGCTGAGCCTCTGG No data
1157862615_1157862623 6 Left 1157862615 18:51154352-51154374 CCTGCGAGCCCCCTGGACTGAGC No data
Right 1157862623 18:51154381-51154403 TAGGCAAACTGTGCAGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157862615 Original CRISPR GCTCAGTCCAGGGGGCTCGC AGG (reversed) Intergenic