ID: 1157865064

View in Genome Browser
Species Human (GRCh38)
Location 18:51175651-51175673
Sequence ACATTCACCAAGAGAGGCAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 196}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157865055_1157865064 13 Left 1157865055 18:51175615-51175637 CCTTCCTGATATGGGAAAACCCA 0: 1
1: 0
2: 2
3: 18
4: 171
Right 1157865064 18:51175651-51175673 ACATTCACCAAGAGAGGCAATGG 0: 1
1: 0
2: 2
3: 21
4: 196
1157865049_1157865064 25 Left 1157865049 18:51175603-51175625 CCATCCCAAAGCCCTTCCTGATA 0: 1
1: 0
2: 2
3: 34
4: 272
Right 1157865064 18:51175651-51175673 ACATTCACCAAGAGAGGCAATGG 0: 1
1: 0
2: 2
3: 21
4: 196
1157865054_1157865064 14 Left 1157865054 18:51175614-51175636 CCCTTCCTGATATGGGAAAACCC 0: 1
1: 0
2: 1
3: 9
4: 158
Right 1157865064 18:51175651-51175673 ACATTCACCAAGAGAGGCAATGG 0: 1
1: 0
2: 2
3: 21
4: 196
1157865059_1157865064 -6 Left 1157865059 18:51175634-51175656 CCCAGGTGGCCATTTCCACATTC 0: 1
1: 0
2: 3
3: 12
4: 169
Right 1157865064 18:51175651-51175673 ACATTCACCAAGAGAGGCAATGG 0: 1
1: 0
2: 2
3: 21
4: 196
1157865057_1157865064 9 Left 1157865057 18:51175619-51175641 CCTGATATGGGAAAACCCAGGTG 0: 1
1: 0
2: 1
3: 7
4: 118
Right 1157865064 18:51175651-51175673 ACATTCACCAAGAGAGGCAATGG 0: 1
1: 0
2: 2
3: 21
4: 196
1157865053_1157865064 20 Left 1157865053 18:51175608-51175630 CCAAAGCCCTTCCTGATATGGGA 0: 1
1: 0
2: 1
3: 11
4: 145
Right 1157865064 18:51175651-51175673 ACATTCACCAAGAGAGGCAATGG 0: 1
1: 0
2: 2
3: 21
4: 196
1157865051_1157865064 21 Left 1157865051 18:51175607-51175629 CCCAAAGCCCTTCCTGATATGGG 0: 1
1: 0
2: 0
3: 13
4: 153
Right 1157865064 18:51175651-51175673 ACATTCACCAAGAGAGGCAATGG 0: 1
1: 0
2: 2
3: 21
4: 196
1157865060_1157865064 -7 Left 1157865060 18:51175635-51175657 CCAGGTGGCCATTTCCACATTCA 0: 1
1: 0
2: 1
3: 20
4: 177
Right 1157865064 18:51175651-51175673 ACATTCACCAAGAGAGGCAATGG 0: 1
1: 0
2: 2
3: 21
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157865064 Original CRISPR ACATTCACCAAGAGAGGCAA TGG Exonic
901875172 1:12163351-12163373 ACAATTACTAAGAGAGGCGAGGG + Intergenic
902079096 1:13809027-13809049 AGATTCACCCAGAGAGGCCTGGG - Intronic
903824225 1:26131064-26131086 AACTTCACCAAGAGAAGCACTGG + Intergenic
912561413 1:110554409-110554431 TCTCTCACCAAGAAAGGCAAGGG + Intergenic
912782777 1:112568293-112568315 ACATTAATCAAGAGTGTCAATGG + Intronic
913319965 1:117581412-117581434 ACTTGCACCCAGAGAGGCAGGGG - Intergenic
917437751 1:175038278-175038300 AGAATAACCAAGTGAGGCAAAGG - Intergenic
917934713 1:179854487-179854509 AAATTCACAAAGAGCAGCAAAGG + Intronic
917957310 1:180113047-180113069 AAATTGACTAAGAGAAGCAAAGG + Exonic
918179082 1:182070473-182070495 CAATTAACCAAGAGAGCCAACGG - Intergenic
918244541 1:182647237-182647259 ACCTTCACCATGGCAGGCAAAGG + Intronic
918604715 1:186409369-186409391 ACAGTAAGCAAGAGAGGCAAAGG - Intronic
920626132 1:207602091-207602113 ACATTCAAAAAGAGAGGAATTGG + Intronic
922187898 1:223292654-223292676 ACATCAACAAAGAGAGGAAAAGG + Intronic
923237301 1:232046543-232046565 AGATTTAACAAGAGAGGGAAAGG - Intergenic
923256012 1:232222302-232222324 TCATGCACCCAGAGAGGCATGGG - Intergenic
1065513583 10:26503893-26503915 ACCTTCAACAAGAAAGGAAAGGG + Intronic
1065637067 10:27743763-27743785 TCATTCACCCGCAGAGGCAAAGG + Intronic
1066049987 10:31624666-31624688 AAATTAACCAAGAAATGCAATGG + Intergenic
1068914463 10:62413751-62413773 GCATTCACCACGAGAAGCAGAGG + Intronic
1070377534 10:75848425-75848447 TCATTCACCCAGTGAAGCAATGG - Intronic
1070400321 10:76047456-76047478 ACCTCAACCAAGAGAGACAATGG - Intronic
1071679957 10:87695006-87695028 ATAGTCACAAAGAGAGGCAAAGG + Intronic
1071867307 10:89748703-89748725 ACATTCACCAAGAGGGACAAAGG - Intronic
1072920183 10:99570255-99570277 ACAGTCACCAGAAGAGGGAATGG - Intergenic
1074784068 10:116823403-116823425 GCATTCACAAAGAAATGCAAGGG + Intergenic
1075149515 10:119914227-119914249 ACATACACCAAAGCAGGCAATGG - Intronic
1075274720 10:121083044-121083066 AGAAGCACAAAGAGAGGCAAAGG + Intergenic
1076271913 10:129160915-129160937 ACACTCACTAACATAGGCAACGG + Intergenic
1076483293 10:130799132-130799154 ACATTCACCAGGATAGAAAAAGG + Intergenic
1078808131 11:14727171-14727193 AAAATCAGCAAGAAAGGCAAAGG - Intronic
1079358642 11:19751919-19751941 ACATTCACCAGTAAAGGCAAAGG + Intronic
1080875340 11:36269843-36269865 ACAATCACCAAGGCAGGGAAAGG - Intergenic
1081145716 11:39561167-39561189 ACACTCACCAAGAGGGTCCATGG + Intergenic
1083428995 11:62604050-62604072 ACAGTCACTCAGAGAGGGAAGGG + Intronic
1085991406 11:81851295-81851317 AGATTAACAAAGAGAAGCAAGGG + Intergenic
1086326563 11:85707320-85707342 TCAGTCACCAAGAGAGGAGAAGG - Intronic
1086510853 11:87556277-87556299 ACATTGACCTAGAGAGGGATGGG + Intergenic
1086642797 11:89180509-89180531 ACATTCATGAAGAGAGAAAAAGG - Intronic
1089032145 11:115342979-115343001 ACATTCATGAAGAGATACAAGGG + Intronic
1089821591 11:121232294-121232316 ATGTTCAACAATAGAGGCAATGG - Intergenic
1093434519 12:19121252-19121274 ACATTCACTAAGAGGGTAAATGG + Intergenic
1094077363 12:26491802-26491824 CCAGTCACTGAGAGAGGCAATGG + Intronic
1094231231 12:28105839-28105861 AAATTTACAAAGAGAGGAAAGGG - Intergenic
1094419113 12:30251959-30251981 ACATTCCCCAAGACAAACAATGG + Intergenic
1095492508 12:42749165-42749187 ACCTTAACCTAGACAGGCAAAGG - Intergenic
1095584419 12:43835218-43835240 ACATTCAGGAAGAGAGGAATTGG + Intergenic
1097156284 12:57014556-57014578 TCATTGACCAAGAGGGGCAGAGG + Intronic
1099116722 12:78635732-78635754 ACATTGACTAAGAGTGTCAATGG - Intergenic
1102431349 12:112886214-112886236 ACAAACACTAAGAGAGGAAAGGG - Intronic
1103489083 12:121302920-121302942 AGATTCACCAAGCCAGGCAAAGG + Intergenic
1104261590 12:127188190-127188212 ACATCGAACAAGACAGGCAATGG + Intergenic
1107593936 13:41941986-41942008 ACATTAAACTTGAGAGGCAAGGG - Intronic
1109631145 13:65048014-65048036 AAATTATCCAAGAGAGGCCAGGG + Intergenic
1109883640 13:68513128-68513150 ACAATCACAAAGGAAGGCAAAGG - Intergenic
1110242630 13:73285893-73285915 CCAGTCACCAAGAGAGGCAAAGG - Intergenic
1110564329 13:76942726-76942748 ACATCCACCAAGACAGGAGAAGG + Intergenic
1112997326 13:105590148-105590170 ACAATCACAAAGAGATGGAAAGG + Intergenic
1113607366 13:111619889-111619911 ACTTTCTCCCAGAGAGCCAAGGG - Intronic
1115409097 14:33052172-33052194 ACCATCCCCAAGAGTGGCAAAGG + Intronic
1118727870 14:68643010-68643032 ACATTCACCAAGACAGACCATGG - Intronic
1121971328 14:98359106-98359128 ACATTTAGAAAGAAAGGCAAAGG - Intergenic
1124934699 15:34159308-34159330 ACATTGACAAAGAGATGAAAAGG + Intronic
1126278942 15:46919387-46919409 ACATTAATCCAGAGAGGAAAAGG + Intergenic
1127361695 15:58249880-58249902 ACATTTATAAAGAGAGACAATGG + Intronic
1127670218 15:61187853-61187875 ACATTAACAAAGTGAGGCACTGG - Intronic
1133103223 16:3491634-3491656 ACAATCACCATGGAAGGCAAAGG + Intergenic
1133404215 16:5510048-5510070 CCATTCTCCAAAGGAGGCAAAGG - Intergenic
1133482037 16:6180224-6180246 AAATTCACCAGTAGAGGCACTGG + Intronic
1134669330 16:16043267-16043289 ACAATCATCAAGACAGGTAAAGG - Intronic
1135235544 16:20752072-20752094 ACATTCAACAAGTGAGGCTGAGG + Intronic
1137832738 16:51559711-51559733 ACAGTCCCCAGCAGAGGCAATGG + Intergenic
1138326933 16:56181461-56181483 ACAGTAACCAAAAGAGGTAAGGG - Intergenic
1139580629 16:67871789-67871811 ACATACACCAAGCCAGGCAGAGG + Exonic
1139846238 16:69923810-69923832 ACATTCGGCAACAGAGGCAAAGG - Intronic
1140886350 16:79247237-79247259 AGATTCAGCAAGTGAGTCAAAGG + Intergenic
1142515222 17:423363-423385 ACATTCACCGTGAGAGGCTCTGG + Intronic
1146011756 17:29200236-29200258 CCATTCACCAAGACAGGAAGAGG - Intergenic
1147253967 17:39170823-39170845 ACATTCAAGAAGAGAAGCAGAGG - Intergenic
1149406720 17:56359504-56359526 GCATTCACCAAGAAATGCAGAGG - Intronic
1151349383 17:73522654-73522676 ACATTGAGCGAGAGAAGCAAGGG - Intronic
1151358894 17:73576687-73576709 ACACTCCCCCAGAGAGGCCAGGG + Intronic
1152149078 17:78587820-78587842 AGATTCACCAAGCCAGACAAAGG + Intergenic
1153466731 18:5396394-5396416 ATAACCACCAAGAGAGGAAAAGG - Intronic
1154173765 18:12068396-12068418 ACGTACGCCAAGAGGGGCAAGGG - Intergenic
1156183001 18:34627662-34627684 CCATGTTCCAAGAGAGGCAAAGG - Intronic
1157455428 18:47824173-47824195 ATCTTCATCAAGAGAGGGAAAGG + Exonic
1157497802 18:48168986-48169008 ACATTCACCAAGGGCTGCCAGGG - Intronic
1157865064 18:51175651-51175673 ACATTCACCAAGAGAGGCAATGG + Exonic
1158206042 18:54993994-54994016 TCATTTACCACAAGAGGCAAAGG + Intergenic
1159023891 18:63165692-63165714 ACATTTACAAAGGGATGCAAAGG + Intronic
1159887698 18:73924748-73924770 ACATCTACCAGGAGAGGGAAAGG + Intergenic
1162585222 19:11554142-11554164 GCCTTCACCAAGGGAGGCAAGGG + Intronic
1163702985 19:18795778-18795800 GCATTCACAAAGGCAGGCAACGG - Intergenic
1164746565 19:30620469-30620491 ACATTCACCCAGATGGGGAATGG + Intronic
1165262570 19:34633162-34633184 ACATTTTCCAAGAGAAGGAAAGG - Intronic
1165788180 19:38474853-38474875 ACATCCACCAAGAGACACAATGG - Intronic
1168608250 19:57776929-57776951 ACAGTCACCCAGACAGGCAGAGG - Intronic
927016050 2:18962585-18962607 AGATACAGCAAGAGAGGAAAAGG + Intergenic
927108253 2:19845727-19845749 ACATACACACACAGAGGCAATGG + Intergenic
927613227 2:24563412-24563434 ACAATCACAAAGACAGGCAGTGG - Intronic
933390519 2:81660950-81660972 ACAATCACCAAGAGCAACAATGG + Intergenic
935076917 2:99754257-99754279 ACAGTCAACAAAAGAGGAAAAGG - Intronic
936709406 2:115114628-115114650 ACTTTCTCCTAGAGAGACAAAGG - Intronic
939246805 2:139635703-139635725 ACAGTCACCAATAGATGCCATGG + Intergenic
939792364 2:146593766-146593788 AAAGTCACCAAGAAAGACAAAGG + Intergenic
943868321 2:192958373-192958395 ACATTCACCACGAGAGTCCGCGG - Intergenic
944442651 2:199758061-199758083 ACATTCAGCAAAACAGGCACAGG + Intergenic
944979462 2:205098714-205098736 CCAGGCACCAAGAGGGGCAACGG - Intronic
947796950 2:232900816-232900838 ACAATCACCCACAGAGGCACTGG + Intronic
1170403223 20:16009881-16009903 ACATTCTCCGAGAGAAGCAGTGG + Intronic
1173264610 20:41467829-41467851 ACATTGACAAGGAGAGGCAGCGG + Intronic
1177029202 21:15961425-15961447 ACATTCACCATCATAGGGAAGGG - Intergenic
1177169955 21:17644202-17644224 AGATTCTCCAAGAAAGACAATGG + Intergenic
1177401646 21:20613431-20613453 ACATTCATGAAGAGAGGGAGAGG + Intergenic
1180003791 21:45009726-45009748 AAATTCACATAGAAAGGCAAAGG - Intergenic
1182788923 22:32932549-32932571 ACAGTCACCAAGAGAGGGGCAGG + Intronic
1184981296 22:48097509-48097531 ACATTCGCCAACAGCTGCAAAGG + Intergenic
949983621 3:9520826-9520848 ACATTCACCAAGACAGGGTCTGG - Intronic
950496840 3:13338898-13338920 AAATTCAGCAAGAGGGGCACAGG - Intronic
950968311 3:17162043-17162065 ACATTCACGAACACAGGTAAAGG + Intronic
952964763 3:38614277-38614299 ACCATCACCAAGAGAGCCACCGG - Intronic
956988280 3:74730348-74730370 AACAGCACCAAGAGAGGCAAAGG - Intergenic
957533863 3:81475750-81475772 ACAGTAACAAAGACAGGCAATGG - Intergenic
961203250 3:125061005-125061027 CCATTCACAAGGAGAGGGAACGG + Intergenic
962359891 3:134730026-134730048 ACATTCAGCAAGAGAGGTCAGGG + Intronic
964713362 3:159695713-159695735 ACATTTACCACTAGAAGCAATGG - Intronic
965134472 3:164744141-164744163 AGAGTCACCTGGAGAGGCAATGG + Intergenic
965199490 3:165638325-165638347 ACATTCAGAAAGAAAAGCAAGGG - Intergenic
966091154 3:176138412-176138434 CCATTTAGCAAGAGAGTCAAAGG - Intergenic
969990497 4:11257493-11257515 ACAGCCACCTAGTGAGGCAAAGG - Intergenic
972231311 4:37075651-37075673 ACATTGATGAAGAGAGGCTAAGG + Intergenic
972304383 4:37818148-37818170 ACAGTCAACAAGAGAGTCAATGG + Intergenic
973785934 4:54332768-54332790 ACAATTACCAAGAGAGGCCAGGG - Intergenic
976780478 4:88752868-88752890 ACTTTCCCCAGGAGAGGGAAAGG + Intronic
978109375 4:104944246-104944268 ATATTCACAAAGACAGGTAAAGG + Intergenic
979140745 4:117171156-117171178 ACACTCACCATGGGAAGCAATGG + Intergenic
979963929 4:127054906-127054928 ATATTCACTAAGAGAACCAAGGG - Intergenic
979989414 4:127356873-127356895 ACAATCACCAAGAAATGCCATGG + Intergenic
979993395 4:127402525-127402547 AAATCCAACAAGAGAGGCGATGG - Intergenic
982513118 4:156309022-156309044 ACATGAACCTAGAGAGGCCAGGG + Intergenic
982523279 4:156447043-156447065 ATATTAACCAAAAGAGGGAAAGG + Intergenic
982967992 4:161939095-161939117 ACATTATCCAAGAAATGCAAAGG + Intronic
983092758 4:163524086-163524108 AGATTAACCAAGAGTAGCAAGGG - Intergenic
984640317 4:182157752-182157774 ACTTTGACCAGGAGAGGTAAGGG + Intronic
985757617 5:1728438-1728460 ACGTTCACCAGAGGAGGCAAGGG - Intergenic
986266782 5:6197597-6197619 TCATTCACCACGAGAGGCAGAGG + Intergenic
986679121 5:10217558-10217580 ACCTTCAGCAAGAAAGGAAATGG + Intergenic
988951768 5:36269463-36269485 ACATTCTGCAAGAAAAGCAATGG + Exonic
992233498 5:74685432-74685454 ATCTTCACCAAGAGCGGCAGGGG - Exonic
994348473 5:98716615-98716637 AGATTTACCAAGAAAGCCAAAGG - Intergenic
994563012 5:101401093-101401115 ACATCCACAAAAGGAGGCAAAGG + Intergenic
994715186 5:103312705-103312727 AAATTCTACTAGAGAGGCAAGGG + Intergenic
994727978 5:103458981-103459003 ACATTCTCCAAATGAGGAAATGG + Intergenic
998731938 5:145088261-145088283 ACAATGACAAAGATAGGCAATGG - Intergenic
1000150160 5:158492341-158492363 ACATCCAGCAAGGGAGGGAAAGG + Intergenic
1000162153 5:158608618-158608640 ACATGCACCTAGAGAGCCATGGG - Intergenic
1000986426 5:167865658-167865680 TCAGTCTCCAAGAGAAGCAAGGG - Intronic
1001317071 5:170651211-170651233 CAAGTCACCAAGAGAGGCAGTGG + Intronic
1002647242 5:180665206-180665228 CCATTCACCACGAGAAGAAATGG + Intergenic
1002901381 6:1412368-1412390 CCATTCAGCAAGAGAAGCGATGG + Intergenic
1003256218 6:4477243-4477265 CCATTCTCCAAAAGAGCCAAAGG + Intergenic
1004027731 6:11835546-11835568 ACAGACCCCAAGAGTGGCAAGGG + Intergenic
1004070706 6:12294713-12294735 ACATTGACTCAGAGAGGCAAAGG - Intronic
1005011462 6:21339798-21339820 CCATTCACAAAAAGAGGGAAAGG + Intergenic
1006059894 6:31411943-31411965 ACATTCACCATGGGGGGCACTGG - Exonic
1006072384 6:31507018-31507040 ACATTCACCATGGGGGGCACTGG - Exonic
1006244846 6:32723391-32723413 ACATTCACCAAGTGAAGCCTTGG + Intergenic
1006561696 6:34918386-34918408 ACAGTCACCATGAGGGTCAAAGG + Intronic
1007021119 6:38522597-38522619 AAGATCTCCAAGAGAGGCAATGG - Intronic
1007140173 6:39564503-39564525 ACATTCCCCAAGACAGCCCAAGG - Intronic
1007470022 6:42083785-42083807 ACTTTTACCAAGACAAGCAAAGG + Intronic
1008112810 6:47511379-47511401 ACATTGACCAGAAGAGGCAAAGG + Intronic
1009268073 6:61580840-61580862 ACACTCACCAAGAGGGTCCATGG + Intergenic
1012442829 6:99277458-99277480 ATATTCAGCAAGTGAGGGAATGG + Exonic
1012789585 6:103676470-103676492 ACACTCACCACGAGAGTCCACGG - Intergenic
1013624349 6:111921651-111921673 CCATTGACCAAGAGAGTAAAAGG - Intergenic
1014107728 6:117585765-117585787 ACATGCACAAAGACAGGCACTGG + Intronic
1018475422 6:164135481-164135503 ACATTCACCACGTCAAGCAAGGG - Intergenic
1018507967 6:164491774-164491796 ATAATCAACAAGACAGGCAAGGG - Intergenic
1020116715 7:5480242-5480264 CCCTTCACCAAGAGCGGCCAGGG + Intronic
1021039575 7:15845282-15845304 ACATTCACCAACAGAGACCGAGG + Intergenic
1021794823 7:24243513-24243535 ATATTAGCCAAGAGAGGCGAAGG + Intergenic
1022839663 7:34151056-34151078 ACATTCACCAAGCTAGATAATGG + Intronic
1027922533 7:84413222-84413244 ACCTTCACTTAGAGAGGCTATGG - Intronic
1030650163 7:112109057-112109079 AAATCCATCAAGAGAGGCAAAGG - Intronic
1030800026 7:113838229-113838251 ACATTCAGTAAGAGAGCCTAAGG + Intergenic
1031373834 7:121000446-121000468 AAATTCACTAATAGAGGCTAGGG + Intronic
1033508430 7:142029746-142029768 AAATTTAACAAGAGATGCAAAGG + Intronic
1036016962 8:4796045-4796067 ACACTCACCAGGAGAGCCACTGG + Intronic
1037990795 8:23320074-23320096 ACGGTCACCAAGAGGGACAAGGG + Intronic
1039305018 8:36251996-36252018 TCATTTACCAAAACAGGCAATGG + Intergenic
1039429238 8:37512674-37512696 ACCTGCAACAGGAGAGGCAAGGG - Intergenic
1039589716 8:38736155-38736177 TCATTATACAAGAGAGGCAAAGG - Intronic
1041454905 8:58048375-58048397 AAATTCCCCCACAGAGGCAAAGG - Intronic
1041498603 8:58514829-58514851 AAATTCACCATGAGAGGAAAAGG + Intergenic
1046740242 8:117820037-117820059 AACATCACCAAGAGGGGCAAAGG - Intronic
1047314542 8:123720405-123720427 CCATTAACCAACAGTGGCAATGG - Intronic
1048651411 8:136482763-136482785 GCATTCACAGAGAGAGGGAATGG - Intergenic
1050350446 9:4736343-4736365 ACATACACAAAGAGAAGCATAGG + Intronic
1051510912 9:17876974-17876996 ACATACAGCAATAGAGGAAAGGG - Intergenic
1053274547 9:36773315-36773337 ACCTTCACAAGGAGAGGCAAAGG - Intergenic
1053541177 9:38975424-38975446 ACATGAACCAAGAGAGGCAGAGG + Intergenic
1053805597 9:41798470-41798492 ACATGAACCAAGAGAGGCAGAGG + Intergenic
1054624963 9:67388482-67388504 ACATGAACCAAGAGAGGCAGAGG - Intergenic
1055483652 9:76734970-76734992 ACACTGACAAACAGAGGCAAGGG + Intronic
1055521752 9:77088449-77088471 ATATTCACCAAGCCATGCAATGG + Intergenic
1058647864 9:107147309-107147331 ACATTCACCAAGAAAGTGGAGGG - Intergenic
1061057362 9:128231563-128231585 ATATACACAAAGATAGGCAAAGG - Intronic
1062694346 9:137865626-137865648 GCAATCACCAAGAGAGGCGCTGG + Intronic
1185986045 X:4835381-4835403 AAATTCAACAGGAGAGGGAAAGG + Intergenic
1187647395 X:21363529-21363551 AGATCCAGCAAGAGAAGCAAGGG + Intergenic
1190060915 X:47211211-47211233 ACCCTCACCAACAGAGGCATTGG - Exonic
1191791811 X:64979114-64979136 ACTGAGACCAAGAGAGGCAAAGG + Intronic
1192126881 X:68509466-68509488 AGACTCACCATGAGATGCAAGGG - Intronic
1195081965 X:101379742-101379764 ATGTTCAGCAAGAGAGGAAATGG + Intronic
1195507475 X:105674435-105674457 AATTTCACCAAAAGAAGCAATGG - Intronic
1197668852 X:129253631-129253653 ACTTTCTCCAAGATAGGCCATGG - Intergenic
1197705896 X:129634339-129634361 AGATACACCAAGAGAGGCACTGG + Intergenic
1200040335 X:153361074-153361096 ATATTCACCAAGAAGGGGAAGGG - Intergenic