ID: 1157865238

View in Genome Browser
Species Human (GRCh38)
Location 18:51177338-51177360
Sequence GACTTGGACGGTGGTTTGAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 52}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157865231_1157865238 0 Left 1157865231 18:51177315-51177337 CCTACCACACGATAAGGGACCCT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1157865238 18:51177338-51177360 GACTTGGACGGTGGTTTGACCGG 0: 1
1: 0
2: 1
3: 1
4: 52
1157865227_1157865238 12 Left 1157865227 18:51177303-51177325 CCAACCACTAATCCTACCACACG 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1157865238 18:51177338-51177360 GACTTGGACGGTGGTTTGACCGG 0: 1
1: 0
2: 1
3: 1
4: 52
1157865226_1157865238 21 Left 1157865226 18:51177294-51177316 CCTTTGGGTCCAACCACTAATCC 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1157865238 18:51177338-51177360 GACTTGGACGGTGGTTTGACCGG 0: 1
1: 0
2: 1
3: 1
4: 52
1157865228_1157865238 8 Left 1157865228 18:51177307-51177329 CCACTAATCCTACCACACGATAA 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1157865238 18:51177338-51177360 GACTTGGACGGTGGTTTGACCGG 0: 1
1: 0
2: 1
3: 1
4: 52
1157865232_1157865238 -4 Left 1157865232 18:51177319-51177341 CCACACGATAAGGGACCCTGACT 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1157865238 18:51177338-51177360 GACTTGGACGGTGGTTTGACCGG 0: 1
1: 0
2: 1
3: 1
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157865238 Original CRISPR GACTTGGACGGTGGTTTGAC CGG Exonic
907747683 1:57230578-57230600 GACATGAACCGTGGTTTGTCTGG - Intronic
912911624 1:113766212-113766234 AACATGGACTGTGGTTTAACTGG - Exonic
923299367 1:232627492-232627514 GACTGGGATGGTGTTTTGAAGGG - Intergenic
1068794898 10:61068719-61068741 GAAATGGGCTGTGGTTTGACTGG + Intergenic
1074156034 10:110800574-110800596 GACTTTGGTGGTGGTTTTACGGG - Intronic
1076437838 10:130458905-130458927 GACTGGGAGGATGGTTTCACAGG + Intergenic
1079350455 11:19687452-19687474 GACCTGGATGGTGGTTACACAGG - Intronic
1081774275 11:45666593-45666615 GACTAGGAAGGTGCTTTGTCTGG + Intergenic
1093036418 12:14336242-14336264 GATGTGGACAGTGGTTTGGCTGG + Intergenic
1095292715 12:40493712-40493734 GAATTTGGCGGTGGTTTGATGGG + Intronic
1095709988 12:45278063-45278085 GAGGTGGAGGGTGGTTTGAGCGG - Intronic
1108727395 13:53198198-53198220 GACTTGGACTGTGGTTAAATGGG + Intergenic
1114949391 14:27729575-27729597 GACTTGCTGGGTGGTTTAACTGG - Intergenic
1115161387 14:30399517-30399539 GACTTATACCGTGGTTTGCCAGG - Intergenic
1129757761 15:78108831-78108853 AACTTGGAAGGTGGTGGGACAGG - Intronic
1130223955 15:82044375-82044397 CACTTGGATGGTGGTCTGCCCGG + Exonic
1132661892 16:1065404-1065426 GCCTTGGGCGGAGGTTAGACAGG + Intergenic
1137774637 16:51044837-51044859 GACTTGAACGGTGGTGGCACAGG + Intergenic
1146536235 17:33655015-33655037 GTCTTGGACAGTGTCTTGACTGG + Intronic
1146742560 17:35299273-35299295 GAATGGCAGGGTGGTTTGACTGG - Intergenic
1149862274 17:60128731-60128753 GACTTGGACGGTGGGGTGAAGGG - Intergenic
1150203510 17:63381382-63381404 GACTTGGACTATGGTTTTCCTGG + Intronic
1157865238 18:51177338-51177360 GACTTGGACGGTGGTTTGACCGG + Exonic
1158605965 18:58896473-58896495 GACATGGGTGGTGGCTTGACTGG - Intronic
1164723551 19:30450443-30450465 GAGGTGGAAGGTGGTTGGACTGG - Intronic
1168386327 19:55966247-55966269 GACTTAATCGGTGTTTTGACGGG + Exonic
926211861 2:10877173-10877195 GACTTGGGTGGTGGTTACACAGG + Intergenic
931873792 2:66490293-66490315 GATTTGGAGGGTGGGTTGGCTGG + Intronic
933248537 2:80002829-80002851 GATTTAGATGTTGGTTTGACAGG - Intronic
937851103 2:126637199-126637221 GACTTGGACGGTGCTTCCATGGG + Intergenic
1174846270 20:53946187-53946209 GATTTGGATGGTGGTTTTAGGGG - Intronic
1181757397 22:25033976-25033998 GACTGTGATGGTGGTTTCACAGG - Intronic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
953226472 3:41026173-41026195 GAATTGAACTGTGTTTTGACTGG - Intergenic
981206810 4:142051469-142051491 GACTTGGGTGGTGGTTTCATCGG + Intronic
982337367 4:154255636-154255658 GACTTGGACAGTGGTTTGAACGG - Exonic
988936541 5:36089012-36089034 GACTTCGGTGGTGGTTTTACAGG - Intergenic
993565856 5:89474180-89474202 AACTTGGATGGTGATTTGATTGG + Intergenic
996295882 5:121915966-121915988 GACTTGGCAGCTGGTTTGATTGG - Intergenic
1000753422 5:165125725-165125747 GACTCGGAGGGTGGTTGGGCCGG + Intergenic
1006791443 6:36703850-36703872 GACCTGGAGGGTGGTTACACAGG - Intronic
1009950518 6:70390081-70390103 GACTTGGATGGTGGTTAAATGGG + Intergenic
1011379548 6:86727891-86727913 GAATTGGACAATGTTTTGACTGG + Intergenic
1016129342 6:140446546-140446568 TACTTGGACAGTGGATTGATGGG + Intergenic
1024205470 7:47155939-47155961 GACTTACACTGTGGTTTGCCAGG - Intergenic
1037963397 8:23116279-23116301 CACTTGTACTGTGGGTTGACTGG + Intronic
1042984227 8:74565646-74565668 GGCTTGGTCAGTGGTTTGAGGGG + Intergenic
1049794241 8:144489261-144489283 GACTGGGAGGGGGGTTGGACTGG + Intronic
1049794295 8:144489391-144489413 GACTGGGAGGGGGGTTTGTCTGG + Intronic
1052440030 9:28484364-28484386 AACTTGGACGGATGTATGACAGG - Intronic
1060472240 9:123957636-123957658 GACTTTGACGATGGTTCGAGTGG + Intergenic
1061054287 9:128214138-128214160 GAGTTGGACGGTGGGTTTCCTGG - Intronic
1061656448 9:132094904-132094926 GACTTACACCGTGGTTTGCCAGG - Intergenic
1185762810 X:2701274-2701296 GACTGGGAGGGTGGATGGACAGG - Intronic
1192382823 X:70635951-70635973 GACTTGGACCGTGGCTCCACTGG - Intronic