ID: 1157866204

View in Genome Browser
Species Human (GRCh38)
Location 18:51187170-51187192
Sequence GGGTATTTCCTTACATAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 130}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157866200_1157866204 11 Left 1157866200 18:51187136-51187158 CCAAACATGTCTTGTTCCTCTTC 0: 1
1: 0
2: 2
3: 38
4: 413
Right 1157866204 18:51187170-51187192 GGGTATTTCCTTACATAATCTGG 0: 1
1: 0
2: 0
3: 10
4: 130
1157866197_1157866204 14 Left 1157866197 18:51187133-51187155 CCCCCAAACATGTCTTGTTCCTC 0: 1
1: 0
2: 2
3: 17
4: 267
Right 1157866204 18:51187170-51187192 GGGTATTTCCTTACATAATCTGG 0: 1
1: 0
2: 0
3: 10
4: 130
1157866199_1157866204 12 Left 1157866199 18:51187135-51187157 CCCAAACATGTCTTGTTCCTCTT 0: 1
1: 0
2: 3
3: 27
4: 349
Right 1157866204 18:51187170-51187192 GGGTATTTCCTTACATAATCTGG 0: 1
1: 0
2: 0
3: 10
4: 130
1157866195_1157866204 26 Left 1157866195 18:51187121-51187143 CCCAGACTTCATCCCCCAAACAT 0: 1
1: 0
2: 0
3: 11
4: 191
Right 1157866204 18:51187170-51187192 GGGTATTTCCTTACATAATCTGG 0: 1
1: 0
2: 0
3: 10
4: 130
1157866196_1157866204 25 Left 1157866196 18:51187122-51187144 CCAGACTTCATCCCCCAAACATG 0: 1
1: 0
2: 0
3: 23
4: 146
Right 1157866204 18:51187170-51187192 GGGTATTTCCTTACATAATCTGG 0: 1
1: 0
2: 0
3: 10
4: 130
1157866198_1157866204 13 Left 1157866198 18:51187134-51187156 CCCCAAACATGTCTTGTTCCTCT 0: 1
1: 0
2: 2
3: 38
4: 392
Right 1157866204 18:51187170-51187192 GGGTATTTCCTTACATAATCTGG 0: 1
1: 0
2: 0
3: 10
4: 130
1157866203_1157866204 -5 Left 1157866203 18:51187152-51187174 CCTCTTCTATCTCTGCTCGGGTA 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1157866204 18:51187170-51187192 GGGTATTTCCTTACATAATCTGG 0: 1
1: 0
2: 0
3: 10
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157866204 Original CRISPR GGGTATTTCCTTACATAATC TGG Intronic
907694552 1:56709635-56709657 AGGTAATTCCATTCATAATCAGG - Exonic
909115440 1:71528614-71528636 TGGAATTTCTTTACATAATATGG + Intronic
911975629 1:104490231-104490253 AGCTAATTCCTTACATGATCAGG - Intergenic
912866231 1:113259699-113259721 GGATATTTCCATACATTATTTGG + Intergenic
919121499 1:193346427-193346449 GGGTATTTTCACACAGAATCAGG + Intergenic
920707863 1:208267833-208267855 GGGAGTTTGCTTAAATAATCAGG - Intergenic
922087191 1:222361974-222361996 GATTATTGCCTTCCATAATCAGG - Intergenic
923953032 1:238981864-238981886 GTGTATTTCCTTACATAAGTGGG - Intergenic
924157035 1:241188844-241188866 GTGTATTTCCTCATATAATTTGG - Intronic
924767501 1:247047335-247047357 GTGTATTTCCATACATCCTCTGG + Intronic
1065964398 10:30759312-30759334 GGGTGTTTATTTCCATAATCGGG - Intergenic
1068193515 10:53685429-53685451 TTGTATTTCCTTACATATTTGGG - Intergenic
1072531366 10:96322515-96322537 GGGTATTTCCCTAATTGATCTGG - Intronic
1075959895 10:126559331-126559353 GGGTTTCTCCTTACATCAGCGGG + Intronic
1077535401 11:3121731-3121753 GGGTCTTTGCAGACATAATCAGG + Intronic
1079105098 11:17566091-17566113 GGGTATTTCCACAGATAATGTGG + Intronic
1081375954 11:42358908-42358930 GGGTATTTGCATACATTATTTGG - Intergenic
1085748180 11:79132970-79132992 GGTTATTTCCTTACTTATGCTGG - Intronic
1087186134 11:95197901-95197923 GGGTATTTTGTGACATAACCTGG + Intronic
1089479588 11:118793284-118793306 GGCTATTTCCTTACATTAGAAGG - Intergenic
1089948578 11:122504124-122504146 GGGGATTTCTTTCCATGATCTGG + Intergenic
1098841656 12:75484955-75484977 GGGTAGATCCTTACATAAGCTGG + Intronic
1099530558 12:83774871-83774893 GTTGATTTCCTTACATATTCTGG - Intergenic
1099561383 12:84179625-84179647 TCTTATTTCCTTACATATTCAGG + Intergenic
1101850550 12:108398787-108398809 GGAGATTACCCTACATAATCTGG + Intergenic
1105257676 13:18755059-18755081 AGGTTTTTCCGTACATACTCTGG + Intergenic
1105258081 13:18758129-18758151 AGGTTTTTCCATACATACTCTGG + Intergenic
1105260328 13:18774367-18774389 AGGTTTTTCCGTACATACTCTGG + Intergenic
1105260739 13:18777436-18777458 AGGTTTTTCCATACATACTCTGG + Intergenic
1105262099 13:18787081-18787103 AGGTTTTTCCATACATACTCTGG + Intergenic
1106674023 13:31938225-31938247 GGAGATTTCCTCACATATTCTGG + Intergenic
1108293645 13:48989240-48989262 TTGTATTTCCATAAATAATCTGG - Intronic
1109558718 13:64018222-64018244 AGTCATTTTCTTACATAATCAGG - Intergenic
1109941471 13:69372138-69372160 GTGTATTTGCTTACTTAATAAGG + Intergenic
1113304898 13:109066907-109066929 GGCTGTTTCGTTTCATAATCTGG + Intronic
1113583686 13:111448376-111448398 GGGGATTGCCTTCCATAATGTGG + Intergenic
1114199670 14:20508203-20508225 GGATATTTTCTTAAACAATCAGG + Intronic
1202835316 14_GL000009v2_random:73870-73892 AGGTTTTTCCGTACATACTCTGG - Intergenic
1124396501 15:29306366-29306388 GGCTATTTCCTTTCATATTCAGG - Intronic
1127716622 15:61654993-61655015 TGGAATTTCCTTTCACAATCAGG + Intergenic
1129950109 15:79578695-79578717 GGTTAATTCCTTACATATTCCGG + Intergenic
1130288530 15:82575533-82575555 GGGTATTTTCTCACATATTGTGG - Intronic
1135163872 16:20121668-20121690 AGGTATTTTCTGACTTAATCAGG - Intergenic
1137005876 16:35274051-35274073 AAGTATTTCCTTACATCAGCCGG - Intergenic
1139303584 16:65964781-65964803 GGGAAGTCCCTTACAAAATCTGG - Intergenic
1143283713 17:5773553-5773575 GGGGATTTGCTTCCATCATCCGG + Intronic
1152132772 17:78486925-78486947 GGACATTTCATTACATCATCTGG + Intronic
1154425275 18:14267356-14267378 AGGTTTTTCCATACATACTCTGG - Intergenic
1154428427 18:14290014-14290036 AGGTTTTTCCATACATACTCTGG - Intergenic
1154432971 18:14322595-14322617 AGGTTTTTCCATACATACTCTGG - Intergenic
1157053925 18:44202202-44202224 GGTTATTTCCTTTATTAATCTGG - Intergenic
1157636708 18:49163671-49163693 AGGTAACTACTTACATAATCTGG + Exonic
1157776980 18:50403464-50403486 AAGTATTTCCTTACATTAGCCGG + Intergenic
1157866204 18:51187170-51187192 GGGTATTTCCTTACATAATCTGG + Intronic
1161896862 19:7089052-7089074 GGGCTTTTCCTTACATGTTCAGG + Intergenic
1164063493 19:21694904-21694926 AAGTATTTCCTTACATCAGCCGG - Intergenic
929460593 2:42100110-42100132 GGGTATTTCCTTATAGCAACGGG + Intergenic
933055840 2:77663631-77663653 GGGTAATTCATTACACAATTTGG - Intergenic
933578102 2:84092790-84092812 AGGCATTTCCTTACATCCTCTGG + Intergenic
934617895 2:95786361-95786383 GGGTACTTACTGACAGAATCTGG - Intergenic
934642998 2:96038198-96038220 GGGTACTTACTGACAGAATCTGG + Intronic
936258618 2:110937832-110937854 CAGTTTTTCCTTACATAATATGG + Intronic
936983374 2:118285020-118285042 GGTTATTTCCTTCCACAAACTGG + Intergenic
937056559 2:118942127-118942149 GGATGTTTCCTGACATGATCAGG - Intergenic
937684219 2:124678250-124678272 GGGAAATTCCTGACATACTCAGG - Intronic
938562068 2:132481869-132481891 AAGTATTTCCTGACAAAATCAGG - Intronic
939248856 2:139661086-139661108 GAGTGTTTCCTAACAAAATCTGG - Intergenic
941414767 2:165206253-165206275 GGGTATTTACAGAGATAATCAGG - Intergenic
943119236 2:183712897-183712919 TGGTAGTTCTTTACATATTCTGG + Intergenic
946546941 2:220754088-220754110 GTGTCTTTTCTTATATAATCGGG + Intergenic
1170463827 20:16604709-16604731 AGGTCTTTCCTTACTTTATCTGG + Intergenic
1171883476 20:30634503-30634525 AGGTTTTTCCTTACATACTCTGG + Intergenic
1171883890 20:30637575-30637597 AGGTTTTTCCATACATACTCTGG + Intergenic
1176849074 21:13898950-13898972 AGGTTTTTCCATACATACTCTGG + Intergenic
1178009676 21:28269890-28269912 GGGTATGTCTTTATATAAGCAGG - Intergenic
1183798799 22:40143854-40143876 TGGTAATTCTTTACATACTCTGG - Intronic
950962661 3:17121927-17121949 GGGGCTTTCCTTAAAAAATCTGG - Intergenic
951134890 3:19093765-19093787 TAGGATTTACTTACATAATCTGG - Intergenic
952779489 3:37081382-37081404 GTGTATTTCATTACAGAAGCAGG - Intronic
958563807 3:95781661-95781683 AGGAATTTCCATACATCATCTGG - Intergenic
959063391 3:101635301-101635323 AAGTATTTCCTTACATCAGCCGG + Intergenic
960304913 3:116049537-116049559 GGGTGGTTACTTACATAATATGG + Intronic
961064962 3:123867345-123867367 GGGTATTTGCAGATATAATCAGG + Intronic
965770537 3:172177148-172177170 GTGTATTTCCTTGTAGAATCTGG - Intronic
966529242 3:180956140-180956162 GAGGATTTCCTTACACATTCGGG + Intronic
967403730 3:189093636-189093658 GGCTATTTCCTTTCATTTTCAGG + Intronic
970856169 4:20651341-20651363 TGGTATTTCATTACATAACCTGG + Intergenic
973367129 4:49216775-49216797 GGGTTTTTCCGTACATACTCTGG + Intergenic
973367552 4:49219846-49219868 AGGTTTTTCCATACATACTCTGG + Intergenic
973393495 4:49575586-49575608 AGGTTTTTCCGTACATACTCTGG - Intergenic
975907797 4:79235413-79235435 GGGTATTTGCTTACATAGATTGG - Intronic
976814103 4:89126908-89126930 GGGTCTTTGTTAACATAATCTGG - Intergenic
979909173 4:126338946-126338968 GGATAATTCCTTCAATAATCTGG - Intergenic
981008354 4:139898795-139898817 GGGTCATTCATTACATAAGCAGG - Intronic
986281905 5:6330359-6330381 AGGTATTTCCATACATCCTCTGG - Intergenic
987078350 5:14404288-14404310 GGATAGTTCATTTCATAATCTGG - Intronic
988531687 5:32033322-32033344 TGCTACTTCCTGACATAATCTGG + Intronic
990052309 5:51519392-51519414 GGGTATTTTTTCCCATAATCTGG - Intergenic
990352811 5:54935632-54935654 CTGTGCTTCCTTACATAATCTGG + Intergenic
994280180 5:97892669-97892691 GGGTCTTTGCTTATGTAATCAGG + Intergenic
994826973 5:104725404-104725426 TTGTATTTCCTTAAAGAATCTGG + Intergenic
997917204 5:137939384-137939406 GGCTATTTTCTCACATTATCTGG + Exonic
999860281 5:155637968-155637990 AGGTATTTGCTTACATCATTAGG - Intergenic
1003006434 6:2386943-2386965 GGGTCTTTGCTGACATAATCAGG + Intergenic
1003936482 6:10979735-10979757 GATTATTTCCTTGCATACTCTGG + Intergenic
1004228674 6:13811985-13812007 GGGCATTTCCTTCCCTCATCAGG - Intronic
1005460040 6:26059389-26059411 TAGTATTGCCTTACATCATCAGG - Intergenic
1015180763 6:130360115-130360137 GCTTATTTCCTTATATAAACAGG + Intronic
1017113833 6:150957788-150957810 GGGTTTTTCTTAACATAAACAGG - Intronic
1020496780 7:8863449-8863471 GGCTATTTCCTCACACAATGGGG + Intergenic
1021270336 7:18577133-18577155 GTTTATTCCCTTACAAAATCTGG - Intronic
1022017871 7:26367625-26367647 GGGTACTACCTTACACAACCCGG - Intronic
1022124135 7:27339530-27339552 GTGTATTTTCCTACATAGTCAGG - Intergenic
1022610068 7:31862164-31862186 GGGTGTTTTATTACATAGTCAGG - Intronic
1023320059 7:38986409-38986431 GGTTATTTCCTTCCAAAAACAGG + Intronic
1024469779 7:49755522-49755544 GGGTATTTCCTGAAATAAGGAGG + Intergenic
1026246453 7:68624465-68624487 GGGTATTTTCCTACATTAACAGG + Intergenic
1027347668 7:77278035-77278057 GGGTGTTTTCCTACATAATAAGG - Intronic
1029066680 7:97856816-97856838 GGGTATTTCTTTATATAATAAGG - Exonic
1031025650 7:116676857-116676879 AGGTATTTCCCTACAAAAACAGG - Intronic
1036030756 8:4969330-4969352 TGGCATTTCCTTATATAATGAGG + Intronic
1044904276 8:96983193-96983215 TGGTATTTTCTTCCATATTCAGG + Intronic
1046836349 8:118805933-118805955 GGGAATCACCTTACATAATCAGG - Intergenic
1047031102 8:120881739-120881761 GGATATTTGATTACATAATAAGG + Intergenic
1047243349 8:123115352-123115374 GAGGATTTCCTTACATTCTCTGG + Intronic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1053665331 9:40313633-40313655 AGGTTTTTCCGTACATACTCTGG - Intronic
1053914917 9:42938680-42938702 AGGTTTTTCCGTACATACTCTGG - Intergenic
1054376482 9:64453663-64453685 AGGTTTTTCCGTACATACTCTGG - Intergenic
1054519284 9:66062651-66062673 AGGTTTTTCCGTACATACTCTGG + Intergenic
1056295740 9:85191348-85191370 TGGTATTTCCTAACCTGATCTGG + Intergenic
1059167297 9:112090263-112090285 AGGTAATTCCTTGCAAAATCTGG + Intronic
1203545375 Un_KI270743v1:124223-124245 AGGTTTTTCCGTACATACTCTGG + Intergenic
1189029424 X:37435380-37435402 GAGTATTTACATACATAATTTGG - Intronic
1189845219 X:45129839-45129861 GGGTAATTCTTTATATATTCTGG + Intergenic
1193534189 X:82692408-82692430 GGGTGTTTCCATACAGAGTCAGG - Intergenic
1193851908 X:86547180-86547202 ACCTATTTCTTTACATAATCGGG - Intronic
1196011623 X:110893913-110893935 GGGTATTCCTATAAATAATCTGG - Intergenic
1196900133 X:120374487-120374509 GGGTATATCCTTATATATCCTGG - Intronic
1196900163 X:120374878-120374900 GGGTATATCCTTATATATCCTGG + Intronic
1201404379 Y:13635187-13635209 GGGTATTTTCCTTCATAATGAGG - Intergenic