ID: 1157866776

View in Genome Browser
Species Human (GRCh38)
Location 18:51194873-51194895
Sequence GTGGAGGAACAATGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 411}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157866776_1157866782 26 Left 1157866776 18:51194873-51194895 CCCTCCTCACATTGTTCCTCCAC 0: 1
1: 0
2: 1
3: 42
4: 411
Right 1157866782 18:51194922-51194944 TCCTTCCTACCCATTTTCCAAGG 0: 1
1: 0
2: 4
3: 24
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157866776 Original CRISPR GTGGAGGAACAATGTGAGGA GGG (reversed) Intronic
902360941 1:15942321-15942343 GTGCAGGAAGAAGGTGAGGGGGG - Exonic
902935743 1:19763404-19763426 GTTGAGGGACAATAAGAGGATGG + Intronic
903108111 1:21102689-21102711 GAGGAGGAAAAATAGGAGGATGG - Intronic
903228957 1:21910270-21910292 GGGCAGGAACAATTTCAGGAAGG - Intronic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
907117175 1:51979134-51979156 ATGGAGGAAGAAAGTGAGGTTGG + Intronic
907272595 1:53299581-53299603 CTGGATGACCAATGTGAGGCTGG - Intronic
907317248 1:53580227-53580249 GTGCAGGAACCAGGTCAGGATGG - Intronic
908408988 1:63843862-63843884 GTGGAGGACTAATATGAAGAGGG - Intronic
908666759 1:66501060-66501082 GTGGCGGCATAATGTGGGGAAGG + Intergenic
909075901 1:71050096-71050118 GTGGAGTAACAGTGTGAAGCTGG + Intergenic
909675731 1:78237272-78237294 ATGGAGGAAAATTGAGAGGAGGG + Intergenic
910441716 1:87259883-87259905 TTATAGGAACTATGTGAGGAAGG + Intergenic
910784069 1:90975022-90975044 GTGGATAAAAAATGTGGGGAAGG - Intronic
911098332 1:94073993-94074015 GTAGAGGCACCATGAGAGGAGGG + Intronic
911130300 1:94380973-94380995 GTGGGGGCAAACTGTGAGGAAGG - Intergenic
912190578 1:107334856-107334878 GTAGAGGACCATTCTGAGGACGG + Intronic
912499099 1:110110119-110110141 GAGGAGGAAGGAAGTGAGGAAGG + Intergenic
913247952 1:116886892-116886914 GTGGAGAAAGAATCTAAGGAAGG - Intergenic
913569135 1:120102797-120102819 GTGGAGGAGCAATGCAGGGAGGG + Intergenic
914289944 1:146263788-146263810 GTGGAGGAGCAATGCAGGGAGGG + Intergenic
914550987 1:148714571-148714593 GTGGAGGAGCAATGCAGGGAGGG + Intergenic
915227678 1:154422853-154422875 GATGAGGAACCAGGTGAGGAGGG - Intronic
915257088 1:154641887-154641909 GAGGAGGAAGAGGGTGAGGAGGG - Intergenic
916021237 1:160794340-160794362 GTGGAGGGAGAATGGGTGGAAGG - Intergenic
917051699 1:170931982-170932004 GTGGAGGGAAAATGTGGGGTTGG - Intergenic
917408752 1:174736599-174736621 GTGGAGGAAAAATGTGGGGCTGG - Intronic
918217455 1:182404865-182404887 GTGGAGGATCAAAGTTAGCACGG - Intergenic
920891003 1:209985637-209985659 GCAGAGGGAAAATGTGAGGATGG - Intronic
921953261 1:220955721-220955743 GTGGTGTAACAGTGTTAGGAAGG + Intergenic
922018090 1:221673414-221673436 ATGAAGGAACATTGTTAGGATGG + Intergenic
922749527 1:228064054-228064076 GTGAAGGACCACTGTGAAGATGG + Intergenic
923512234 1:234662400-234662422 GTGGATGAACCAGGTGAGGGTGG + Intergenic
1063017777 10:2095704-2095726 GTGGAGGGACAGAGAGAGGATGG + Intergenic
1063216225 10:3928078-3928100 TTGGGGGAAGAATGTGATGAAGG - Intergenic
1063993602 10:11594630-11594652 CTGGCGGAGCAATGTGAGAAAGG - Intronic
1064107567 10:12512976-12512998 CTGGAGGAACACAGTGGGGATGG + Intronic
1065131183 10:22621933-22621955 CTGAAAGAACAATGAGAGGAAGG + Intronic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1066628456 10:37434015-37434037 CTGGAGGAGCAGTGTGGGGAGGG + Intergenic
1066695840 10:38076896-38076918 GTGGAGGAAAAATGTGGGTTTGG - Intergenic
1067811007 10:49427223-49427245 GGGCAGGAACAATGTGACGATGG - Intergenic
1068580160 10:58730537-58730559 GTGGAGGAGAAATGTGGGGTTGG - Intronic
1069195323 10:65544369-65544391 GAAGAAGAACAATGTGGGGAAGG - Intergenic
1070386054 10:75925593-75925615 GTGGAGGAAGAAGGTGATGGTGG + Intronic
1070402868 10:76068750-76068772 TTGGAAGAAAAATGTGATGATGG + Intronic
1072742152 10:97915862-97915884 GTGGAGGAACAGAGGGAGGCTGG - Intronic
1072815784 10:98507739-98507761 AAGGAGGAACAAAGGGAGGAAGG - Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1073900817 10:108218380-108218402 TTAGAGGAACAATATGAGGCTGG + Intergenic
1074244224 10:111671300-111671322 GTGGTGGTAAAATGTGGGGAGGG - Intergenic
1074434488 10:113422265-113422287 GTGGAGGAAGAATTGGGGGAGGG + Intergenic
1075420903 10:122299620-122299642 GTGGAGGAACACTGGGGGCAGGG - Intronic
1076544158 10:131232734-131232756 GTGGTGGAACAAGGAGGGGAGGG - Intronic
1077376290 11:2206230-2206252 GTGGAGGGACATTGGGAGAAGGG + Intergenic
1077768660 11:5190571-5190593 GTGGAGGAAAAATATGAGGTTGG + Intergenic
1078368258 11:10724103-10724125 GGGGAGGACCACTGTGGGGAGGG + Intergenic
1079733672 11:23968306-23968328 GTGGAGGACCGAGGTGAGGGAGG - Intergenic
1080095404 11:28400064-28400086 ACGGTGGAAGAATGTGAGGACGG - Intergenic
1080335064 11:31186242-31186264 GTGGAGGAACAAGGAGAGTATGG - Intronic
1080431945 11:32207533-32207555 GAGGAGGAACTCTGTGAGGACGG + Intergenic
1080957087 11:37110766-37110788 GTGGAGAAATAATTTCAGGAGGG + Intergenic
1081041547 11:38220644-38220666 TTGTGGGAACCATGTGAGGATGG - Intergenic
1081628600 11:44671739-44671761 GTGGAGGGGCAATGTGGGGTTGG + Intergenic
1082972931 11:59042815-59042837 GTGAAGGAACAGTGGGAGGTTGG + Intronic
1082977335 11:59086385-59086407 GTGAAGGAACAGTGGGAGGTTGG + Intergenic
1083311130 11:61784323-61784345 AAGGAGGAACCATGTGAGGAGGG + Exonic
1083375292 11:62215420-62215442 GAGGAGGAATAATGTGAGCAAGG - Intergenic
1083832508 11:65241802-65241824 CTGGAGGAACAATAGGAGGGTGG + Intergenic
1084218237 11:67663127-67663149 CTGGAGGAACAATGTGAGTTGGG + Exonic
1084445119 11:69199171-69199193 ATGGAGGATCAATGAGTGGATGG - Intergenic
1084950701 11:72663877-72663899 GTGGAGGGACAAAGAGATGATGG - Intronic
1085286240 11:75363612-75363634 ATGGAGGAAGAATGAGAGGCTGG + Intergenic
1085418410 11:76335258-76335280 GTGGAGGAGAAATGTGGGGCTGG + Intergenic
1086218236 11:84408921-84408943 GTGGAGGATGAATGGAAGGAAGG - Intronic
1086769565 11:90745121-90745143 GTGGAAGAAAAATGTGGGGTTGG + Intergenic
1087324907 11:96709842-96709864 GTGGTGGCACAAGGTGAGGTGGG - Intergenic
1088447688 11:109949933-109949955 GTGGAAGAGAAATGTGAGGTTGG - Intergenic
1088953829 11:114598429-114598451 GTGGAGGGACAATGTGGGGCTGG - Intergenic
1088976872 11:114823514-114823536 GTGAAGGAACAAAGAGAAGAGGG - Intergenic
1089103296 11:115982152-115982174 GTGGGAGAGCAAAGTGAGGATGG - Intergenic
1089459038 11:118642062-118642084 GTGAAGGAAGAAGGGGAGGAAGG - Intronic
1089767331 11:120777423-120777445 GCGGAGGTACAATGTGACTATGG - Intronic
1090072265 11:123554260-123554282 TTGGAGGAATAACTTGAGGAAGG + Intronic
1090485719 11:127110349-127110371 GTGGAGAAATAATAGGAGGAGGG - Intergenic
1090743161 11:129684916-129684938 GTGCAGGAACCATGTCATGATGG - Intergenic
1090854938 11:130602917-130602939 GTGGAGGAGCAGTGAGGGGAGGG + Intergenic
1091544311 12:1490896-1490918 GCCGAGGAACAGAGTGAGGAAGG - Exonic
1091856985 12:3748173-3748195 GGGGTGGAAAAATGTGAGGCTGG - Intronic
1091875843 12:3932072-3932094 GTGGGGGAACAAGGGAAGGAGGG + Intergenic
1091899734 12:4135099-4135121 GGGGTGGAAGAATGTGAGGTTGG - Intergenic
1092191944 12:6527684-6527706 TTGCATGAACAAAGTGAGGAAGG - Intronic
1092586949 12:9909801-9909823 GGTGGGGAACAATGTGAGCAGGG + Intronic
1093540673 12:20280536-20280558 GTGTAGGAATAATGAGAGAAAGG - Intergenic
1094586523 12:31782192-31782214 GTGGCTGGACATTGTGAGGAAGG + Intergenic
1095353177 12:41239315-41239337 GTGGAGGAATGTTGTGGGGAGGG + Intronic
1095639255 12:44468077-44468099 GTGGAGGGGAAATGTGAGGTTGG + Intergenic
1095929941 12:47615101-47615123 GTGAGGGAACAATGAGAAGATGG - Intergenic
1096751419 12:53761288-53761310 GGGGAGGAACAGTGTGAAGGAGG - Intergenic
1097796741 12:63870785-63870807 GTGGAGGAATATTGTGAGGCAGG - Intronic
1098073809 12:66704808-66704830 CTAGAGGAATAATGGGAGGAAGG - Intronic
1100800561 12:98226190-98226212 ATGGAGGAGCAATGGGGGGAGGG + Intergenic
1101052102 12:100874206-100874228 GTGGAGGGAAAATGTGAGGTTGG + Intronic
1102145562 12:110652456-110652478 GGGGAGGTACAATGTGGGCAAGG + Intronic
1102254536 12:111407820-111407842 GTGGAGGAGGATAGTGAGGAGGG + Intronic
1103458803 12:121087760-121087782 GGTGAGGAAGAATGTGAGCAAGG - Intergenic
1103485863 12:121282239-121282261 GAGCAGGAACAAAGTGGGGAAGG + Intronic
1103940085 12:124496640-124496662 GTGGAGGGGCATTGGGAGGAAGG + Intronic
1104620919 12:130312302-130312324 ATGCAGGAAGAATGTGAGGATGG - Intergenic
1104829977 12:131743744-131743766 GTGGAGGGGAAATGTGAGGTCGG - Intronic
1105001990 12:132696006-132696028 GAGGAAGAACAACATGAGGAAGG - Exonic
1105662157 13:22508426-22508448 CTGGAGGAAAAATGGGAAGAAGG - Intergenic
1106002317 13:25735602-25735624 GAGGAGGATGAATGAGAGGAAGG + Intronic
1106343978 13:28858450-28858472 GTGGATGAAGAATGGGAGGAAGG - Intronic
1107355026 13:39557460-39557482 GTGGAGGGAAAATGTGGGGTTGG + Intronic
1107642776 13:42460874-42460896 GTGGTGGAAGAATGTGTGTAGGG - Intergenic
1107901146 13:45015729-45015751 CTGGAGGAAGAGTATGAGGAAGG + Intronic
1108883995 13:55156826-55156848 GTGGAGGAGAAATGTGGGGTTGG + Intergenic
1110579070 13:77097747-77097769 CTGCATGAAAAATGTGAGGATGG - Exonic
1110901815 13:80834101-80834123 GTGGAGGAAAAATGTGTGGTTGG - Intergenic
1111144873 13:84166879-84166901 GTGGAGGGAAAATGTGAGGTTGG - Intergenic
1111648658 13:91063201-91063223 GTGGAGGCAGAATATGAGTAGGG + Intergenic
1112163029 13:96888996-96889018 GTGGAAGAAAAATGTGGGGTGGG - Intergenic
1112552038 13:100430483-100430505 CTGGAGGAACACAGAGAGGATGG - Intronic
1112610891 13:100953489-100953511 GAAGAGGAGCAATGTGAAGAAGG - Intergenic
1113090112 13:106609126-106609148 GGGGAGGTACGATGTAAGGATGG + Intergenic
1114482588 14:23044785-23044807 CTGGAGGAAGCATGTGAGGAGGG + Intergenic
1114691679 14:24588215-24588237 TTGGAGGAAAAGTGAGAGGAGGG - Intergenic
1116998322 14:51347133-51347155 GTGGAGGAGAAATGTGGGGTTGG + Intergenic
1118734046 14:68689724-68689746 GTGGAGGTTCAAAGTGAGGGGGG + Intronic
1118890582 14:69905130-69905152 GTGTAAGAACAATATGATGATGG + Intronic
1119205928 14:72793543-72793565 ATGGAGGTAGAGTGTGAGGATGG - Intronic
1119333651 14:73814474-73814496 GTGGAGGGGTGATGTGAGGAGGG + Intergenic
1119533676 14:75382018-75382040 GTGGTGGTATAATGTGAGGAGGG - Intergenic
1119657174 14:76425508-76425530 GGGGAGGAAGGAGGTGAGGAGGG - Intronic
1119953537 14:78770758-78770780 GAGGAGGAACAAAGTAAGTAAGG + Intronic
1119964244 14:78895826-78895848 GAGGAAGAAAAATGTGAGAATGG + Intronic
1120076928 14:80169509-80169531 GTGGGGGAACAATGCCAGAATGG - Intergenic
1121505175 14:94471828-94471850 GAGGAAGAACGATGTGGGGAAGG - Intronic
1122426174 14:101607477-101607499 GTGGAGGAGGAAGGAGAGGAAGG - Intergenic
1123881169 15:24678249-24678271 CTGGAGGAACCATGATAGGAAGG - Exonic
1124410226 15:29430695-29430717 GTGGGGGAAGGATGGGAGGAAGG + Intronic
1124668358 15:31614143-31614165 TTGGGGGAAGAATGGGAGGAGGG + Intronic
1125753042 15:42043346-42043368 GTGAGGGAAATATGTGAGGAAGG + Intronic
1126123286 15:45272441-45272463 TTGGAGGAATAATATGAGGAAGG + Intronic
1126374812 15:47986810-47986832 GTGGTGAAACAAAGTGAGGCAGG + Intergenic
1128301378 15:66568140-66568162 GTGGAGGCACAGAGTGGGGAAGG + Intergenic
1128646449 15:69382098-69382120 GTGGAGGAACAGTGTGGAGGAGG + Intronic
1129072760 15:72964711-72964733 GTGGTAAAACTATGTGAGGATGG + Intergenic
1129117908 15:73375480-73375502 GAGGAGGAAAAGCGTGAGGAGGG + Intergenic
1130281327 15:82522342-82522364 TTGGAGGAAGATTGTGGGGAGGG - Intergenic
1130472702 15:84238525-84238547 TTGGAGGAAGATTGTGGGGAGGG - Intronic
1130480193 15:84353096-84353118 TTGGAGGAAGATTGTGGGGAGGG - Intergenic
1130484422 15:84390667-84390689 TTGGAGGAAGATTGTGGGGAGGG - Intergenic
1130491576 15:84435033-84435055 TTGGAGGAAGATTGTGGGGAGGG + Intergenic
1130503191 15:84514073-84514095 TTGGAGGAAGATTGTGGGGAGGG + Intergenic
1130594996 15:85243159-85243181 TTGGAGGAAGATTGTGGGGAGGG - Intergenic
1135823851 16:25708845-25708867 GTGGATGAAAAATGGAAGGATGG - Intronic
1137810038 16:51343973-51343995 GTGGAGGAATAGTGTGGGGAGGG - Intergenic
1139189649 16:64847309-64847331 GTGGAGGGACAAAGAGAGGAAGG - Intergenic
1141488466 16:84356161-84356183 GTGTAGGAACACAGTGCGGATGG + Intergenic
1141968951 16:87466913-87466935 GTAAAGAAACAAGGTGAGGAGGG - Intronic
1142319288 16:89370670-89370692 GTGGAGGAACAAGGCCAGGTGGG - Intronic
1142478543 17:204357-204379 GTGGAGGACAGATGGGAGGATGG - Intergenic
1143161787 17:4876714-4876736 GCGGAGGCAGAAAGTGAGGATGG - Intronic
1144751777 17:17653739-17653761 GTGGAGGGGAAATGTGGGGATGG - Intergenic
1145817793 17:27808004-27808026 GTGAAGGAAGAATTGGAGGAAGG + Intronic
1145853760 17:28132097-28132119 ATGGAGGAAAAATGTAAAGAAGG - Intronic
1146803393 17:35845017-35845039 ATGGAGGCAAAATGGGAGGAAGG + Exonic
1147772990 17:42880267-42880289 GATGAGGATCAAAGTGAGGAGGG + Intergenic
1148931831 17:51133151-51133173 GTGGAGGAAAAAAGTGACAAAGG - Intergenic
1149525449 17:57351985-57352007 GTGAAGAAACACTGAGAGGAAGG + Intronic
1150265326 17:63828575-63828597 GTGAAGTGAGAATGTGAGGAAGG + Intronic
1151232462 17:72694666-72694688 GTGGAGGAACCTTGTGGGCAGGG + Intronic
1151482505 17:74378744-74378766 GGGGAGGACCAAAGTGAGCATGG - Intergenic
1151535057 17:74734507-74734529 GTGGAGGAAGAATGAGAGAGGGG - Intronic
1151632812 17:75322491-75322513 ATGCAGGAAGAAGGTGAGGAGGG + Intronic
1151763244 17:76119365-76119387 GTGGAGGCAAAGTGTGAGCAAGG + Intronic
1151764750 17:76126985-76127007 GGGGAGGAACATTGTAGGGAGGG - Intergenic
1152336691 17:79703025-79703047 GTGGAGGAGGAGTGGGAGGAAGG - Intergenic
1152403410 17:80082996-80083018 GAGGAGGAGCAAAGTGTGGATGG + Intronic
1152675376 17:81637411-81637433 GTAGAGAAACAATTTCAGGAAGG + Intronic
1153057022 18:955965-955987 GTGGTGGAAGAAGGGGAGGAAGG - Intergenic
1153468524 18:5416317-5416339 GTGGGGGCACAATGGGTGGATGG + Exonic
1155045089 18:22096307-22096329 CTTGAGGAACTATGTGAGGCAGG - Intronic
1155276242 18:24190159-24190181 GTGGAGAAACAATGGAAGCATGG + Intronic
1155738934 18:29261703-29261725 ATGGAGGAACAAAGTAGGGATGG - Intergenic
1155946445 18:31857652-31857674 GTAGAAGAACAGTGTCAGGAAGG + Exonic
1155958999 18:31978119-31978141 GAGGAGGAACAACGTGAGTAAGG + Intergenic
1156769669 18:40704063-40704085 GTTGAATAACACTGTGAGGAAGG - Intergenic
1156803130 18:41142962-41142984 GTGGAAGAACAATTTTAGGTCGG - Intergenic
1157311413 18:46556014-46556036 CTGGAGGAAAAATCTAAGGAAGG + Intronic
1157866776 18:51194873-51194895 GTGGAGGAACAATGTGAGGAGGG - Intronic
1162054725 19:8055827-8055849 GTGCAGGTGCACTGTGAGGAGGG - Intronic
1162202201 19:9028640-9028662 GTAGAGGAAGAAGGTGAGGATGG + Intergenic
1163272333 19:16261813-16261835 GTGGAGGGGCAATGTGAGCCTGG + Intergenic
1164977311 19:32582825-32582847 GAGGAGTAAGAAGGTGAGGAAGG - Intronic
1167435128 19:49474706-49474728 GGGGAGGCACAATGTCAGGATGG + Intronic
1167575663 19:50316304-50316326 GAGGAGGAAGGATGGGAGGAGGG + Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167782216 19:51606107-51606129 CTGGAGGATCCAGGTGAGGATGG - Intergenic
1167838011 19:52090579-52090601 CTTGAGTAACAATGTGAGGCTGG + Intronic
1168028630 19:53662351-53662373 GTGGAGGAACTTTGAGGGGAGGG + Intergenic
1168173274 19:54605241-54605263 TTGGGGGAATATTGTGAGGAGGG - Intronic
925072851 2:984635-984657 GTGAAGGAGCAATTTCAGGACGG - Intronic
925217525 2:2110398-2110420 TTGGAGGATGAATATGAGGAGGG - Intronic
925768866 2:7263085-7263107 GAGGAGGAAGAACGTGAGGGTGG + Intergenic
926461128 2:13130728-13130750 GTGGAGGGAAAATGTGGGGTTGG + Intergenic
927212387 2:20646765-20646787 GTGGAGGAGGAAGGTGAGGCTGG + Intronic
927582242 2:24262529-24262551 AGGGAGAAACACTGTGAGGATGG - Intronic
930469399 2:51793695-51793717 GTGGAGGTAAAATGTGGGGTTGG - Intergenic
930978431 2:57492904-57492926 ATAGAGGAATAGTGTGAGGAAGG - Intergenic
931332165 2:61299001-61299023 TTAGGGGAATAATGTGAGGAGGG - Intronic
932109991 2:68989991-68990013 TTGGAGGAAGAATATGAGCAAGG - Intergenic
932963837 2:76447146-76447168 GGGTAGGAGCAATGTGAGAAGGG - Intergenic
933453146 2:82483064-82483086 GGGGAGGAAGAAAGGGAGGAAGG - Intergenic
934652351 2:96099830-96099852 GAGGAGGAGGAATGGGAGGAGGG + Intergenic
934947981 2:98555748-98555770 GTGGAGGGGCATGGTGAGGAGGG - Exonic
937530359 2:122820188-122820210 ATGGAGGAACAATTTAAGCAAGG - Intergenic
938015456 2:127863479-127863501 GTGGGGGCACAATCTGAGAAAGG - Exonic
940691640 2:156926350-156926372 GAGGAGGAAGAATGTGGGGTTGG - Intergenic
941207143 2:162588057-162588079 GTGCAGGAGCGATGGGAGGAAGG - Intronic
941431838 2:165422912-165422934 GTGGAGGGAAAATGTGGGGTTGG - Intergenic
941698339 2:168577159-168577181 GTAGAGGAAACATCTGAGGATGG + Intronic
942378058 2:175357120-175357142 GAGGAGGTGCAATGTGAAGATGG - Intergenic
942519702 2:176790782-176790804 GTGGAGGATCCAGGAGAGGAAGG - Intergenic
942697760 2:178665029-178665051 TTGGTGGAACAAAGGGAGGATGG - Intronic
943202771 2:184850083-184850105 GTGGGGGTAAAAAGTGAGGATGG + Intronic
943337647 2:186637824-186637846 ATGGATGGACAATGAGAGGATGG - Intronic
943645045 2:190401080-190401102 GTGCAGGAACAAGGGGAGGGTGG + Intergenic
943731300 2:191306114-191306136 GTGGAGAAACAACGTGGGGAAGG + Intronic
944479737 2:200144439-200144461 GTGGAGGGAAAATGTGAGGTTGG - Intergenic
946051616 2:216867515-216867537 ATGGAGGATGTATGTGAGGAGGG - Intergenic
946943873 2:224799161-224799183 GTGGAGGAAGGATGGGAGGAAGG - Intronic
947192753 2:227526156-227526178 GAGTAGGAACATTGTGAGGTTGG + Intronic
947805105 2:232961080-232961102 TTGGATGAACTCTGTGAGGATGG + Intronic
1169795033 20:9452960-9452982 TTTGAGGACCAATGTGTGGAAGG + Intronic
1170784767 20:19457974-19457996 CTGGAGGAAAAAGGTGGGGAAGG - Intronic
1172439495 20:34955660-34955682 CGGGAGGAACGATGTGAGGGAGG - Intronic
1172780886 20:37436401-37436423 GGGGATGAATAATGGGAGGATGG - Intergenic
1173192595 20:40887581-40887603 GGGGAGGAGCAATGAGAGAATGG - Intergenic
1173853380 20:46233142-46233164 GAGGAGGAACTAGGAGAGGAAGG + Intronic
1175293699 20:57894740-57894762 GGGAAGGAACAAAGGGAGGAAGG + Intergenic
1175383912 20:58582117-58582139 GTGGAGGAACAGGGAAAGGAGGG + Intergenic
1175886702 20:62296002-62296024 GTGGAGGAAGAACGGTAGGAAGG + Exonic
1176876018 21:14130034-14130056 GTGGAGGAAACATTTTAGGATGG + Intronic
1177512352 21:22105250-22105272 GTGGAAGAAAAATGTGAAGCTGG - Intergenic
1177565645 21:22817993-22818015 GAGGGGGAACAGGGTGAGGAAGG + Intergenic
1177807693 21:25890194-25890216 GTGGATGAGCAGTGTGAGGAAGG - Intronic
1179125892 21:38590231-38590253 GTGGAGGCATAATGTGGTGAGGG + Intronic
1181440851 22:22934611-22934633 GTGGAGGGATCATGTGTGGAGGG + Intergenic
1181440860 22:22934640-22934662 GTGGAGGGATCATGTGTGGAGGG + Intergenic
1181440872 22:22934683-22934705 GTGGAGAAATCATGTGTGGAGGG + Intergenic
1181446465 22:22979061-22979083 TTGGAGGAACAGTGCCAGGAAGG - Intergenic
1182885527 22:33770885-33770907 GAGGAGGAAGAATGTGAGAATGG - Intronic
1183503588 22:38195982-38196004 GAGGAGGAAGAAGGGGAGGAGGG + Intronic
1183733080 22:39629188-39629210 GTGGAGCACCAGGGTGAGGACGG - Intronic
1184867377 22:47209269-47209291 CTGGAGGAAGAATGTGGGGCTGG + Intergenic
950487333 3:13281491-13281513 GAGGAGGAGCATTGTGAGGATGG - Intergenic
952638167 3:35557248-35557270 GTGGAGGAAGAAAGTGAAGTGGG + Intergenic
953237879 3:41121830-41121852 GTGGAGGACTACTGGGAGGAGGG + Intergenic
956410439 3:68973297-68973319 GGGGAGGAAGAAAGGGAGGAAGG - Intergenic
956514627 3:70033358-70033380 GGGGAAGAATAATGTGAGGAGGG + Intergenic
960089660 3:113626567-113626589 GAGGAGGAGGAATGTGAGTATGG - Intronic
960144987 3:114191465-114191487 GAGGTGGAACAAGGTGAGGCTGG + Intronic
960837935 3:121926636-121926658 GTGGAGGTAAAATGTGGGGTTGG + Intronic
961520451 3:127464686-127464708 GAGGAGGAGGAATGTGAGGTGGG + Intergenic
962601203 3:136992076-136992098 GTGGAGGTGCAAGGTAAGGATGG + Exonic
966225297 3:177591317-177591339 TTGGAGGAGCAAAGAGAGGAGGG - Intergenic
966295310 3:178413704-178413726 GTGTAGGAAGAGTATGAGGAGGG + Intergenic
966648078 3:182269233-182269255 CTGAAGGAACAATATGAGTAAGG - Intergenic
967218725 3:187231426-187231448 GGGGAGGAAGAATGTGGGAAAGG - Intronic
967443786 3:189540732-189540754 GTGCAGGAGCAAGGTGAGGGGGG - Intergenic
970050480 4:11908785-11908807 GTGAAGGAACAAAGTGAGAAGGG - Intergenic
972877617 4:43383212-43383234 GTTGTGGAATAATGAGAGGAAGG - Intergenic
973187735 4:47350961-47350983 GTGGATGAACAAAGTGATGTTGG + Intronic
973634124 4:52846251-52846273 GGGGAGGAAGAAGGTGGGGAAGG - Intergenic
973665311 4:53153176-53153198 GTGGAGGGGAAATGTGAGGTTGG - Intronic
974179852 4:58370654-58370676 GTGGAGGAATAGAGAGAGGAAGG - Intergenic
975705941 4:77112168-77112190 CTGGAGGGAAAATGAGAGGAAGG - Intergenic
977572341 4:98641786-98641808 GTGTAGGAACAGTGTGCAGAGGG - Intronic
977913773 4:102567071-102567093 GTGGGAAAACACTGTGAGGATGG + Exonic
978165491 4:105602047-105602069 GTGGATGAACAACTTCAGGATGG + Intronic
978487791 4:109275908-109275930 GTGGAGGGAGGTTGTGAGGAAGG - Intronic
979821441 4:125177489-125177511 AGTAAGGAACAATGTGAGGACGG + Intergenic
980407017 4:132366501-132366523 GTGGAGGGAAAATGTGGGGTTGG - Intergenic
981902289 4:149880719-149880741 GGGGAGGAAAAATATGGGGAGGG + Intergenic
981923892 4:150117049-150117071 GTGGAGGGACAATGCCAGGTGGG + Intronic
982066197 4:151656923-151656945 GTGGAGGAGGAATTTAAGGAGGG - Intronic
982346007 4:154360318-154360340 GTGGAGGAAGAAATTGAGGCTGG - Intronic
983231025 4:165129005-165129027 GTGGAGGAACAGTGAGGAGAAGG + Intronic
983469293 4:168136811-168136833 GTGGGGGAAAAATGTGGGGTTGG - Intronic
984016742 4:174435684-174435706 GTGGTGGAAAAAAGTGAGAATGG + Intergenic
984405836 4:179328756-179328778 GTGGAGGAATAAGGTGAAGTTGG + Intergenic
984524077 4:180836007-180836029 GTGGAGCAAAACTGGGAGGAGGG - Intergenic
986837145 5:11651436-11651458 GTGGAGGGGAAATGTGAGGTTGG + Intronic
986872780 5:12069588-12069610 CTGGAGAAGCAATGTGATGAAGG + Intergenic
988016199 5:25563287-25563309 GTAGAGGGAAAATGTGAGGTTGG - Intergenic
988272312 5:29032779-29032801 GTGGAGGGAAAATGTGAGATTGG - Intergenic
989106953 5:37871928-37871950 GTCTGGGAACAATGGGAGGAAGG - Intergenic
989756209 5:44958726-44958748 GAGGAGGAACAAGAAGAGGAAGG - Intergenic
991357791 5:65787959-65787981 GAGGAGGAAAAACGTGAGGGAGG - Intronic
992781344 5:80131062-80131084 TTTGAGGAAGAGTGTGAGGATGG + Intronic
993278271 5:85890680-85890702 GTGGAGGAACACTGTGTTGGTGG + Intergenic
993310113 5:86319180-86319202 GAGGAGGAAGAAGGAGAGGAAGG - Intergenic
993890456 5:93466216-93466238 TTGGAGGAAACATGAGAGGAAGG - Intergenic
994073142 5:95622991-95623013 AAGGAGGAACAAAGAGAGGAAGG - Intergenic
994177976 5:96732884-96732906 GTGAAGGAACAATGAGAAGATGG + Intronic
995915615 5:117241734-117241756 GTGGAGGAGAAATGTGGGGTTGG + Intergenic
995971203 5:117973621-117973643 GTGGAGGGGAAATGTGAGGTTGG - Intergenic
995978530 5:118073051-118073073 ATGGTGGAGCAATGTGAGAAAGG + Intergenic
996384410 5:122895702-122895724 GTTGAGGAACATGGTGAGGGTGG - Intronic
996480884 5:123973772-123973794 GTGGAGGAGAAATGTGGGGTTGG - Intergenic
997182270 5:131842857-131842879 GTGGAGGGAAAATGTGGGGTTGG - Intronic
997251720 5:132393733-132393755 TGGGAGAAACAAGGTGAGGATGG - Exonic
997716862 5:136048997-136049019 GTCGAGTGACAGTGTGAGGAGGG + Intronic
998096112 5:139396296-139396318 GTGGAGAAACAATCTGGGAAGGG - Intergenic
999547159 5:152642359-152642381 GTGGAGGAATGATGTGAGCGAGG - Intergenic
999642906 5:153689767-153689789 GGAGAGGAACAATGTGAGTAGGG - Intronic
1001147727 5:169199436-169199458 AGGGAGGAACACTGTGCGGAAGG + Intronic
1001341130 5:170846596-170846618 GTGGAGGGGGGATGTGAGGATGG - Intergenic
1001407473 5:171486072-171486094 GTGGGGGAACACTGTCAGGTGGG + Intergenic
1001735662 5:173997254-173997276 GGGCAGGAACAAGGTGGGGAAGG + Intronic
1001822078 5:174718349-174718371 GTGGAGGCAGAAAGGGAGGAGGG + Intergenic
1002327686 5:178420523-178420545 GGGGAGGAGGAAAGTGAGGAGGG - Intronic
1002968480 6:1991053-1991075 GGGTAGGAACATTGAGAGGAGGG - Intronic
1003727629 6:8783555-8783577 GGGGAGGATCAATGTGGGGAGGG - Intergenic
1003852438 6:10239005-10239027 GTTAAGGAAGAATGAGAGGAAGG - Intergenic
1006143233 6:31943511-31943533 GTGGAGGGTCAATGTGGGTAAGG + Exonic
1006438565 6:34039790-34039812 ATGGGGGAATAAGGTGAGGAGGG - Intronic
1007139528 6:39556641-39556663 GTGGGAGAACAAGGTTAGGAAGG + Intronic
1007762065 6:44139025-44139047 GTGAAGGAAGGATGGGAGGAGGG - Intronic
1008032581 6:46713693-46713715 GTGGTGGAAGAAAGTGAAGAGGG + Intronic
1009745975 6:67816391-67816413 GTGGAGAAAGAATATGATGAGGG - Intergenic
1010249160 6:73690852-73690874 GTGGAGAAAGAAAGAGAGGAAGG + Intergenic
1010865755 6:80975111-80975133 GTGGACGGAAAATGTGAGGTTGG + Intergenic
1010898236 6:81392566-81392588 GTGGAGGAGAAATGTGGGGTTGG + Intergenic
1011489018 6:87871816-87871838 TTGATGGAACAATGTGAGGTGGG + Intergenic
1012021976 6:93934201-93934223 CTGGAGGGACAATTTGAAGATGG + Intergenic
1013207825 6:107960060-107960082 GTGCAGAAAAAAAGTGAGGAGGG - Intergenic
1015815700 6:137208765-137208787 GTGGAAGGAAAATGTGAGGTCGG + Intronic
1015933864 6:138388722-138388744 GTGGAGGTAAAGTGTGGGGAAGG - Intergenic
1017391877 6:153948844-153948866 GTGGAGGAAGGTTGGGAGGAAGG + Intergenic
1017692195 6:156978044-156978066 GTGAAGAAACCACGTGAGGATGG - Intronic
1017721904 6:157249392-157249414 GTGGACCACCTATGTGAGGAGGG + Intergenic
1017744775 6:157436605-157436627 TTGCAGGAATAATGTGATGATGG + Intronic
1017781839 6:157721460-157721482 GTGGAGGAGCAATTAGAGAAGGG - Intronic
1019062373 6:169265673-169265695 GTGGAGGAAGCACTTGAGGAAGG + Intergenic
1019157512 6:170049272-170049294 GAGGAGGAACATGGTGTGGAGGG - Intergenic
1022873881 7:34507889-34507911 GGGGAGGGACAATGTGGGAAGGG - Intergenic
1023022743 7:36025278-36025300 TTGAAGCAATAATGTGAGGAAGG + Intergenic
1023071782 7:36441959-36441981 GAGGAGGAAAAAGGTGAGGCAGG + Intronic
1023188518 7:37555356-37555378 GTGGAGGAGAAATGTGGGGTTGG - Intergenic
1023548327 7:41342576-41342598 GTGCAGGAACTGTGTTAGGATGG + Intergenic
1023677254 7:42643367-42643389 GTGGAGAGGTAATGTGAGGATGG - Intergenic
1023690317 7:42779431-42779453 GTGGAGAAAAAATGTGGGGTTGG + Intergenic
1024220003 7:47279742-47279764 GTGGAGCAACGGTGTGATGAAGG + Intronic
1024645619 7:51368243-51368265 GTGGAGGAGAAATGTGGGGTTGG - Intergenic
1024820238 7:53320223-53320245 GAGGAGAAACAAAGTGAAGAAGG - Intergenic
1025084319 7:56010206-56010228 CTGGAGGAAAAATGGGGGGAGGG - Intergenic
1028018669 7:85744659-85744681 GAGGAGGAATAATGTGAGCAGGG + Intergenic
1028951292 7:96638127-96638149 ATGGAGGAACGAGGTGAAGAAGG - Intronic
1029412707 7:100426098-100426120 TTTGAGGAACAATATAAGGAAGG - Intronic
1030279591 7:107758692-107758714 GTGGAGGCATAATATGATGAGGG - Exonic
1031668936 7:124519158-124519180 GTGGAGGGAAAATGTGGGGTTGG + Intergenic
1032019104 7:128396713-128396735 GCAGAGGAACAATGTGAGGATGG + Intronic
1032576375 7:133059411-133059433 ATGGAGGAGGAAAGTGAGGAGGG + Intronic
1032650385 7:133871671-133871693 GTAGAGGAAGAATGTGAAGCAGG - Intronic
1032803046 7:135331791-135331813 GTGGAGGCAAAATGTGGGAAGGG - Intergenic
1033897580 7:146093716-146093738 GTGAAGAAACAAAGTGAGAAGGG + Intergenic
1037694694 8:21213411-21213433 GTGGAGTAAGAATGGGAAGAGGG - Intergenic
1037835833 8:22214244-22214266 GAGGAGGAACACTCAGAGGACGG + Intergenic
1037956941 8:23067788-23067810 GAGGAGGAACAGTGAAAGGAAGG - Intronic
1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG + Intergenic
1038178514 8:25203911-25203933 GTTGAGGAGCAATTTTAGGAAGG - Intronic
1042140741 8:65676039-65676061 TTGGAGGAGGAATGTGAGTAAGG + Intronic
1042504179 8:69541978-69542000 GTGGAAGAGGAATATGAGGAAGG + Intronic
1042952879 8:74219775-74219797 GAGAAGGCACAATGTGCGGAGGG + Intergenic
1044335636 8:90981566-90981588 GTGAAGGAGGAATGTAAGGAAGG - Intronic
1045305850 8:100956076-100956098 GGGGAGGAAAAATGAGAGTAAGG + Intergenic
1046093342 8:109529014-109529036 GTCGAGGAAGAATTTGAGGTGGG + Intronic
1046878030 8:119277675-119277697 GTGGAGGAAAAATGTGGGGTTGG - Intergenic
1047158338 8:122347794-122347816 GAGAAGGAACAAAGTGAGCAAGG + Intergenic
1047171409 8:122496625-122496647 GAGGATGAAGAATGTGAGGAGGG + Intergenic
1047423232 8:124724428-124724450 GTGGAGGAACCAGGTGTGGTTGG + Intronic
1047616365 8:126565572-126565594 GGGGAGGAACTTGGTGAGGAGGG - Intergenic
1048190266 8:132281975-132281997 ATAGATGAAGAATGTGAGGAAGG - Intronic
1048657154 8:136553141-136553163 ATGGATGAAGAAAGTGAGGAAGG - Intergenic
1049240376 8:141534917-141534939 GAGGAGGACCAGTGGGAGGAGGG - Intergenic
1049752029 8:144289477-144289499 GTGGAGGTAGAAGATGAGGAAGG - Intronic
1049780737 8:144427711-144427733 GTGGAGAAACAATGGGAGCGGGG + Intronic
1050290161 9:4145730-4145752 GAGGGGGAACAAAGGGAGGAGGG - Intronic
1051237985 9:15022146-15022168 GTGAAGGAACAAGGTAAGGAAGG - Intergenic
1051527232 9:18059185-18059207 GAGGAGAGACAATGTGATGAGGG - Intergenic
1052303081 9:26975085-26975107 GAGGAGGAATAACGTGAGCAGGG + Intronic
1052686612 9:31765096-31765118 GTGGAGGGAAAATGTGGGGATGG - Intergenic
1052757854 9:32559157-32559179 GGGGAGGAACAGTTTGGGGATGG - Intronic
1053133571 9:35634687-35634709 GGGGAGGAAAAATGGGAGAAAGG - Intronic
1053307009 9:36991790-36991812 GTGGAGGACGAAAGTGATGAGGG - Intronic
1053386598 9:37695998-37696020 GAAGAGGAACAAGGTGAGGCTGG - Intronic
1054835436 9:69671718-69671740 CTGGAGAAAGAATGTGATGATGG - Intronic
1054859264 9:69932432-69932454 GAGGAGGCATAATGTGAGCAGGG + Intergenic
1055825926 9:80324705-80324727 GTTGAGGAACAGTGAGAGTAAGG - Intergenic
1056600396 9:88042545-88042567 GAGGAGAAATAATGTGAGCAGGG + Intergenic
1057003759 9:91537246-91537268 CTGGAGGAAGCAGGTGAGGAGGG + Intergenic
1057302167 9:93893142-93893164 GTGAAGATACAATGAGAGGAAGG + Intergenic
1057419479 9:94899133-94899155 GTGGAGGACTGATGGGAGGAGGG + Intronic
1057846161 9:98526329-98526351 GTGCTGGAGCAATGTCAGGAAGG - Intronic
1058776023 9:108284680-108284702 GTGCAGGAAAACTGTTAGGATGG - Intergenic
1058805081 9:108582743-108582765 TGGTAGGAACACTGTGAGGAAGG - Intergenic
1059104488 9:111500037-111500059 GTGGAGGAACAGTCTCAGGGTGG + Intergenic
1059854594 9:118382700-118382722 GTGGAGGAACAGTCTAGGGAGGG + Intergenic
1059854674 9:118383557-118383579 GTGGAGGAACACTCTAGGGAGGG - Intergenic
1059948141 9:119434056-119434078 GTGGGGGAAGAGTGTGTGGAAGG + Intergenic
1060038821 9:120282098-120282120 GTGGAAAAACAAAGTGACGATGG + Intergenic
1060100761 9:120839228-120839250 GTGGAGGAAAAAAGTGAGGTTGG + Intronic
1061746343 9:132743002-132743024 CTGAAGGAACAAGGGGAGGAGGG + Intronic
1061772334 9:132935591-132935613 CTGGAGGAGCCATGTGAGGCAGG + Intronic
1185446743 X:261852-261874 GAGCAGGAGCAATTTGAGGAGGG + Intergenic
1185708737 X:2285124-2285146 GTGGAGGTGGAATGTGGGGATGG + Intronic
1185929356 X:4185016-4185038 GTGGGGGAAGGATGGGAGGAGGG + Intergenic
1186107134 X:6219604-6219626 ATGGAGGAACGAAGGGAGGAAGG - Intronic
1186433950 X:9527751-9527773 GTGGCGGAACAGTGTGAATATGG - Intronic
1187056706 X:15747498-15747520 GGGGAGGAAAAATGGCAGGAGGG + Intronic
1188115580 X:26238757-26238779 GTGGAGGGAAAATGTGTGGTTGG - Intergenic
1189057386 X:37712367-37712389 TTAGAGGAATATTGTGAGGAGGG + Intronic
1189110694 X:38286378-38286400 GGGGAGGAAGAAGGGGAGGAAGG - Exonic
1189396295 X:40625634-40625656 GTGGGAGGACAATATGAGGATGG + Intergenic
1189533046 X:41906997-41907019 GGTGAGGAACAATGAGAAGAGGG - Intronic
1189644442 X:43112038-43112060 GTGCAGGAAAAATATGAGGCTGG - Intergenic
1189857068 X:45234058-45234080 GCAGAGGAAGAAAGTGAGGAGGG + Intergenic
1190048618 X:47132567-47132589 GAGGAGGAAGAAAGGGAGGAAGG - Intergenic
1190108148 X:47573552-47573574 GAGGAGGAAAAGTATGAGGATGG + Intronic
1190244755 X:48683858-48683880 GTGGGGGCCCAATGGGAGGAAGG + Exonic
1190259809 X:48790773-48790795 GTGGAGGAAGAGCGAGAGGAGGG + Intronic
1190983995 X:55484261-55484283 GCTGAGGAACACTGTGATGAGGG + Intergenic
1191040632 X:56075639-56075661 TTGGTGGAAGAAGGTGAGGATGG - Intergenic
1193406455 X:81107542-81107564 GTGGAGGGAAAATGTGGGGTTGG + Intergenic
1193911251 X:87309419-87309441 GTGGAGGGGAAATGTGAGGTTGG - Intergenic
1194048022 X:89033598-89033620 GTGGAGGGAAAATGTGGGGTTGG - Intergenic
1194084576 X:89510025-89510047 GCAGAGGAAAAATGTGAGGTTGG - Intergenic
1195089579 X:101445766-101445788 GTGGAGGGAGGATGTGAGGAGGG + Intronic
1195327970 X:103773499-103773521 TTCAAGGAACAATGGGAGGATGG - Intergenic
1195465516 X:105174464-105174486 GTGGATGAAGATTGGGAGGATGG + Intronic
1196551543 X:117032601-117032623 CTGGAGGGACAGTGTGAGAAAGG - Intergenic
1196601458 X:117605717-117605739 GTGGAGGAAAAATGTGGAGTTGG + Intergenic
1197866803 X:131027725-131027747 GTGCAGGAAGGATTTGAGGAAGG - Intergenic
1198386007 X:136130293-136130315 GTGGAAGAACCATGTGATGTTGG + Intergenic
1200353771 X:155526511-155526533 GTGGAGGAGAAATGTGGGGTTGG + Intronic
1200437217 Y:3165911-3165933 GCAGAGGAAAAATGTGAGGTTGG - Intergenic
1202088479 Y:21163614-21163636 GGGGAGGAACACTGTGAGTAAGG + Intergenic
1202366730 Y:24170853-24170875 TTGGAGGAAGATTGTGGGGAGGG - Intergenic
1202373675 Y:24214630-24214652 TTGGAGGAAGATTGTGGGGAGGG + Intergenic
1202497106 Y:25455490-25455512 TTGGAGGAAGATTGTGGGGAGGG - Intergenic
1202504052 Y:25499270-25499292 TTGGAGGAAGATTGTGGGGAGGG + Intergenic