ID: 1157869525

View in Genome Browser
Species Human (GRCh38)
Location 18:51217488-51217510
Sequence GGTTCTAATGGAAGAGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 258}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157869525 Original CRISPR GGTTCTAATGGAAGAGAAGG TGG (reversed) Intronic
900280904 1:1867987-1868009 AGTTCTAAAGAAAGAAAAGGGGG - Intronic
901126922 1:6936052-6936074 GGTTTTAACGGAAGAGAAAGAGG - Intronic
902889272 1:19430069-19430091 GGTTCAAATAGATGAGATGGTGG - Intronic
904463872 1:30696711-30696733 GGGTGTCCTGGAAGAGAAGGAGG + Intergenic
904464367 1:30699076-30699098 GGGTGTCCTGGAAGAGAAGGAGG + Intergenic
904711494 1:32433587-32433609 GGCTCTAAGGGAGAAGAAGGAGG - Intergenic
906177607 1:43788918-43788940 GGTCTTAATGGAAGAGTGGGAGG + Intronic
906506673 1:46384905-46384927 TGTTTTAAGGGAAGAGAAGGTGG + Intergenic
908234666 1:62137871-62137893 GGACCTGAAGGAAGAGAAGGAGG - Intronic
908414157 1:63896495-63896517 GTTTATAATGAAGGAGAAGGTGG - Intronic
908434582 1:64092526-64092548 GGATGTTATGGTAGAGAAGGAGG + Intronic
909817688 1:80016797-80016819 GGTGCTGAAGGAAGAGAAAGAGG - Intergenic
910405150 1:86880881-86880903 CAGTCTAATGGAAGAGAAGATGG + Intronic
910711139 1:90182450-90182472 GGTTTTCATGGAAGTGAAGTGGG + Intergenic
911476430 1:98379256-98379278 GGTTCTGATCCAAGAGAAGAGGG + Intergenic
912627429 1:111217248-111217270 GGTTCTATTAGCAGAGAAGAAGG - Intronic
914348257 1:146818121-146818143 GCATCTAATGAAAGAGAAGATGG + Intergenic
916258769 1:162819474-162819496 GGTTCTGATGGAAGTGATGGTGG + Intergenic
917083355 1:171279925-171279947 GATTGTAATAGAAGAGAAAGGGG - Intronic
917641845 1:176990436-176990458 GGTACTAGAGGAAGACAAGGAGG + Intronic
917833553 1:178920271-178920293 GGTTCTAATGAAAGAGATCCAGG + Intronic
918748827 1:188243780-188243802 GGTTCTGAGGGAGGATAAGGTGG + Intergenic
919160000 1:193816702-193816724 GTTTCTAATGGATGAAAAAGTGG - Intergenic
919742740 1:200990540-200990562 GGGTGGAATGGAAGAGAAGGGGG + Intronic
920858870 1:209688572-209688594 GGTTTTATTCGAAGAAAAGGAGG - Intronic
920972204 1:210752611-210752633 GGTACTCAAGGAAGAGGAGGTGG + Intronic
922563752 1:226587764-226587786 GGGTTTCATGGAAGAGAATGAGG - Intronic
924810805 1:247400160-247400182 GGATTTAAAGGAAGAGAGGGAGG + Intergenic
924876951 1:248116157-248116179 AGTTCTGAGGGAAGAGAAAGTGG + Intergenic
1062934589 10:1376506-1376528 GGTTCTTATGGGAGGGCAGGGGG + Intronic
1063522838 10:6756851-6756873 TGTTTTAAAGGAGGAGAAGGAGG + Intergenic
1064949909 10:20836759-20836781 GGGTGTAAAGGAAGAAAAGGGGG - Intronic
1065500337 10:26375251-26375273 GGATGTAATGGAACAAAAGGAGG - Intergenic
1066399281 10:35059066-35059088 GCTTCTTATGGATGAGAAAGTGG + Intronic
1066725218 10:38385147-38385169 GGTTCTCATGGAAGTGATGGTGG + Intergenic
1068812647 10:61273968-61273990 GGTGGTAATGCAAGAGATGGAGG - Intergenic
1068854736 10:61785936-61785958 TGGTCTAATGGAGGAGGAGGAGG + Intergenic
1068944822 10:62719239-62719261 GTTTCTAGTGGAAGAGCAGAGGG - Intergenic
1069021823 10:63497131-63497153 AGTTCTAAAGGAAAAGAAGTTGG - Intergenic
1069295332 10:66836778-66836800 GGTTCAAATGGAAAGGAAAGAGG - Intronic
1070090637 10:73281966-73281988 GATTCTAGTGAAAGAGAAGGTGG + Intronic
1070356122 10:75642082-75642104 GGTTCTGTTGGCTGAGAAGGGGG + Intronic
1070583801 10:77745741-77745763 GGCTATACTGGAAGAGAAAGAGG + Intergenic
1071249855 10:83806584-83806606 GGTTGGAACTGAAGAGAAGGAGG - Intergenic
1072249620 10:93571351-93571373 GCTTCTCCTTGAAGAGAAGGAGG - Intronic
1072733997 10:97867019-97867041 TGTTCTAGTGGAAGAGAAGCCGG + Exonic
1073861319 10:107745035-107745057 GGTTCTAATAGAAGAACAGAAGG + Intergenic
1073863783 10:107777359-107777381 GGATATAAAGAAAGAGAAGGAGG - Intergenic
1077825758 11:5806733-5806755 AGTTCTGAGGGAAGAGAAAGTGG + Intronic
1077931432 11:6737172-6737194 AATTCTCATGGAAGGGAAGGAGG + Intergenic
1078903683 11:15664764-15664786 GTTTAAAATGGAAGAAAAGGAGG + Intergenic
1079592685 11:22199441-22199463 GGTTCTATTAGCAAAGAAGGAGG + Intronic
1079663981 11:23080650-23080672 GGTTCTATAAGAAGAGAAAGAGG - Intergenic
1079736862 11:24008293-24008315 GTTTTTAATGGAAGAAAGGGAGG - Intergenic
1080112579 11:28585061-28585083 GTATCTGAGGGAAGAGAAGGTGG - Intergenic
1084907270 11:72357804-72357826 GGTTCTGCTGGAAGAGAGGCAGG + Intronic
1086867606 11:91998902-91998924 GGTTCTTCTGAAAGAGGAGGTGG + Intergenic
1086987488 11:93266360-93266382 AGTTCTGAGGGAAGAGAAGGTGG - Intergenic
1087640105 11:100747124-100747146 TGTTTTAAGGGAGGAGAAGGTGG + Intronic
1089114437 11:116082909-116082931 GGATGGAATGGAAGAGATGGGGG - Intergenic
1089637264 11:119823066-119823088 GGTTCCAGTGGAAGGGAAGAGGG + Intergenic
1091096452 11:132826929-132826951 GGTATAAAGGGAAGAGAAGGGGG + Intronic
1093069233 12:14691284-14691306 ATATCTAATGGAAGAGAAGTGGG + Intronic
1093996019 12:25643718-25643740 GGTTCTGATGGCAAAGAAGAAGG + Intronic
1094362033 12:29640674-29640696 GGATCCAATGGGAGAGAAGCAGG + Intronic
1096060322 12:48693064-48693086 GGTTCTGATGGCAGAGGTGGTGG + Exonic
1097034130 12:56111309-56111331 GGTTAGTATGGAATAGAAGGTGG + Exonic
1099032934 12:77551066-77551088 GTTTCTAATGGGAGAGGAGGTGG + Intergenic
1099104559 12:78482757-78482779 GGTTTTAAGAGAAGAGAAAGTGG - Intergenic
1099997173 12:89790960-89790982 GTTTCTAATGGAAGTGTGGGTGG + Intergenic
1101900506 12:108788348-108788370 GGAGCTCATGGAAGAGGAGGTGG + Exonic
1102533649 12:113565339-113565361 GGGTCTAGAAGAAGAGAAGGAGG + Intergenic
1103200233 12:119082267-119082289 ACATCTAATGGAAGAGGAGGAGG - Intronic
1105750629 13:23419618-23419640 GATTCGAATGGAAGAAAATGTGG - Intronic
1107470713 13:40688696-40688718 GGTTCTACAGGAAGATAATGTGG - Intergenic
1108573988 13:51776412-51776434 GGTCCTCATGGGAGGGAAGGAGG - Intronic
1108976111 13:56445089-56445111 GGTACTAATGGCAAAGAATGGGG - Intergenic
1109786619 13:67184287-67184309 GGTTATAATGAAAGAAAAGGAGG + Intronic
1110390730 13:74970726-74970748 AGTTCTCATGTATGAGAAGGAGG - Intergenic
1110693970 13:78465252-78465274 GGGACTACTGGAAGAAAAGGAGG + Intergenic
1112608745 13:100934676-100934698 GGTACTAATTCAAAAGAAGGTGG - Intergenic
1113289126 13:108885791-108885813 GGCTCTAAGGGGAGAAAAGGAGG + Intronic
1114223616 14:20718641-20718663 AGTTCTAAGGGAAGAGAAAGTGG + Intergenic
1117218216 14:53574070-53574092 GGTGCTATTGGCAGAAAAGGGGG - Intergenic
1117659525 14:57988981-57989003 GGTTCTAATGGCAGGCAAGTAGG - Intergenic
1119749722 14:77068505-77068527 GGTTGAAAAGGAAGAGAAAGAGG + Intergenic
1119895279 14:78214724-78214746 TCTTCTAATGCAAGACAAGGAGG - Intergenic
1119931101 14:78548325-78548347 GGTTCAAATTTCAGAGAAGGTGG + Intronic
1120093435 14:80360610-80360632 GGTTCTAATGAGAAAGAAGTTGG + Intronic
1120141044 14:80929979-80930001 GGTGGTAATGCAAGTGAAGGGGG - Intronic
1122767909 14:104084510-104084532 GGCTCTCATGGGAGTGAAGGAGG + Intergenic
1123050996 14:105542262-105542284 AGTTTTAATGGAAGAGCAAGTGG + Intergenic
1124048822 15:26176495-26176517 GTGTCTAATGGTAGAGGAGGGGG + Intergenic
1125056002 15:35359468-35359490 GGATCCAATGGGAGAGAAGCAGG - Intronic
1126856836 15:52847154-52847176 AGTTGTAAGAGAAGAGAAGGGGG + Intergenic
1127713504 15:61624826-61624848 TGTCCAAATGGAGGAGAAGGTGG + Intergenic
1128073335 15:64810816-64810838 GGCTTTAATGCAAGAGAAGGTGG - Intergenic
1130610165 15:85354021-85354043 GCTTCTCAGAGAAGAGAAGGAGG + Intergenic
1130862212 15:87901066-87901088 GGTTCAGATGAAAGAGATGGAGG + Intronic
1131461891 15:92623331-92623353 GGTTCTGGGGGATGAGAAGGGGG - Intronic
1131613022 15:93984878-93984900 AGTTCTCAGGGAAGACAAGGTGG + Intergenic
1131711399 15:95059946-95059968 GGTCCTTCTGGAAGGGAAGGTGG - Intergenic
1132932132 16:2464229-2464251 GGTGCTTCTGGAAGAGGAGGTGG + Exonic
1133604972 16:7378069-7378091 GATTCTAATGGAGAAGTAGGAGG + Intronic
1133928744 16:10215114-10215136 GCTTCTTAAGGAGGAGAAGGTGG - Intergenic
1136548324 16:30967630-30967652 GGTTCTGATGGGAGAGCAAGAGG + Intronic
1138232837 16:55351940-55351962 GGTTCTACTGGGAGAGACTGGGG - Intergenic
1138299233 16:55912467-55912489 AGTTGTCATGGAGGAGAAGGAGG + Intronic
1138526157 16:57608498-57608520 GGTTCTATTGGTATAGAAAGGGG + Intergenic
1139985779 16:70897424-70897446 GCATCTAATGAAAGAGAAGATGG - Intronic
1140305761 16:73801070-73801092 GATTCTAATAAAAGAGAAGTTGG + Intergenic
1140630645 16:76847935-76847957 GGGTCTGATGGCAGAGCAGGAGG + Intergenic
1141954872 16:87364061-87364083 GATTATAATGGAACAGGAGGTGG - Intronic
1144073951 17:11700463-11700485 GGTGCTAATGGATGGGAAGGAGG - Intronic
1144207152 17:12987401-12987423 GATTCCAGTGAAAGAGAAGGTGG - Intronic
1146514828 17:33480871-33480893 GGTTGCAGTGGAAGAGAAGGAGG - Intronic
1146997044 17:37330261-37330283 GGACCTACTGGAGGAGAAGGAGG - Exonic
1149341447 17:55690621-55690643 GGTTCTAATGGAAAAAAGAGGGG - Intergenic
1150113155 17:62520051-62520073 GGTTCTAGTGGTAGACTAGGTGG + Intronic
1150629798 17:66871402-66871424 GGGTTTAATTGGAGAGAAGGAGG - Intronic
1151430496 17:74059321-74059343 GGTTATAAAGAAAGGGAAGGGGG + Intergenic
1151688321 17:75662994-75663016 GGTCCTAAGAGAAGAGAAAGAGG + Exonic
1155241141 18:23864847-23864869 GGTTCTTCTGGAAAAGAAGCCGG + Exonic
1155410568 18:25540229-25540251 GCATCAAAAGGAAGAGAAGGAGG + Intergenic
1155882666 18:31169464-31169486 TTTTCTAATGGAAGGGAAGGAGG + Intergenic
1156217439 18:35014200-35014222 TCTGCTAAGGGAAGAGAAGGTGG + Intronic
1156513333 18:37659973-37659995 GCTGCAAAGGGAAGAGAAGGTGG + Intergenic
1156624328 18:38890045-38890067 AATTGTAATGGAATAGAAGGGGG + Intergenic
1157349860 18:46874751-46874773 AGTTCTGAGGGAAGAGAAAGTGG - Intronic
1157869525 18:51217488-51217510 GGTTCTAATGGAAGAGAAGGTGG - Intronic
1158181334 18:54717914-54717936 CCTTCTAATCGAACAGAAGGGGG - Intronic
1159497835 18:69228989-69229011 GGTGCTCATGGATGAGAAGGTGG - Intergenic
1159809301 18:72997245-72997267 GGTTCTGATGAGAGACAAGGTGG - Intergenic
1161452237 19:4352926-4352948 GTTGCTGATGGAAGAGGAGGAGG + Exonic
1162176958 19:8837834-8837856 GGTTAGTAAGGAAGAGAAGGAGG + Intronic
1164306029 19:24004219-24004241 GGTGCTAATGGAAAAGGAGGGGG + Intergenic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1166548492 19:43649140-43649162 GGTTCTGAGGAAAGAGAAGACGG + Exonic
1167906825 19:52668088-52668110 TGTTTTAAAGGAAGAGAAGGTGG - Intronic
924975973 2:175674-175696 GGTTCTAAAGGAAGCTAAGTTGG - Intergenic
925255798 2:2486282-2486304 GGTAGTAATGGAAGAGATGGAGG - Intergenic
925595618 2:5552960-5552982 GGTGGTAACGGTAGAGAAGGTGG - Intergenic
926790964 2:16571361-16571383 GATGCTAATGGAGAAGAAGGTGG + Intronic
927147020 2:20172826-20172848 GGTTATAGGGGAAGAGAAGTGGG + Intergenic
928098502 2:28420646-28420668 GGGCCTAATGGACGAGGAGGAGG - Intergenic
928374260 2:30762343-30762365 TATTCTCATGGAAGAGGAGGAGG - Intronic
929264848 2:39906260-39906282 GGTTTTAATAAAAGAGGAGGAGG - Intergenic
930098677 2:47586525-47586547 GGTTTTAGTGGGAGAGTAGGTGG + Intergenic
931994395 2:67825856-67825878 GTTTCTCTTGGAAGAGGAGGAGG + Intergenic
932388189 2:71358145-71358167 AGGTTTAAGGGAAGAGAAGGTGG - Intronic
932398456 2:71463883-71463905 GGTTCTGCTAGAAGGGAAGGGGG + Intronic
932622539 2:73273526-73273548 GATTCTAATGGAACAGACTGAGG - Intronic
932781855 2:74563742-74563764 GGTTATTATGGAACAGAGGGTGG + Intronic
937057319 2:118949927-118949949 TGTTTCAAGGGAAGAGAAGGTGG + Intronic
937522645 2:122731378-122731400 GGTTCTAATAGAGGAGAGGAGGG - Intergenic
938364580 2:130724962-130724984 TGTTATAATGGAAGTGAAAGTGG + Intergenic
940624031 2:156150138-156150160 GGGTGTAAAGGAAGAAAAGGGGG + Intergenic
945196831 2:207244808-207244830 GGATCTAATGGAAGGCAAAGGGG + Intergenic
946643432 2:221808293-221808315 GGTTTTCAGGGAAGAGAAAGGGG - Intergenic
947085299 2:226444603-226444625 AGTTCTAATGGAAAGGAAAGGGG - Intergenic
948949585 2:241240316-241240338 GGTTGTTGTGGAAGAGAAGTAGG - Intronic
1168822792 20:787004-787026 AGTTCTGAGGGAAGAGAAAGTGG + Intergenic
1169167040 20:3432957-3432979 GCTTATTATGGAAAAGAAGGGGG - Intergenic
1169607548 20:7339735-7339757 TGTTGTAAGGGAAGAGAAGATGG - Intergenic
1169828055 20:9791327-9791349 ACTTCAAATGGAAGAGAAGGTGG - Intronic
1170252552 20:14300801-14300823 GGATGTAATGCAAGAGAATGGGG + Intronic
1170669363 20:18416366-18416388 GGGTCTAGTGGAAAGGAAGGTGG - Intronic
1172578377 20:36027262-36027284 GATTCCAATGGTAGAGAAAGGGG + Intronic
1173085609 20:39913417-39913439 AGGTCTAAAGGAAGAGAAAGCGG + Intergenic
1174996300 20:55572534-55572556 GGTTGACATGGAAGAGTAGGTGG - Intergenic
1175107543 20:56625977-56625999 GGTTCTAAACGAAGAGCATGCGG + Intergenic
1177507164 21:22034165-22034187 GGTTTTAGTGGCAGAGATGGAGG - Intergenic
1178837030 21:36107558-36107580 TGTTTTAAGGGAAGAGAAGGTGG - Intergenic
1181375741 22:22456640-22456662 AGTTCTGAGGGAAGAGAAAGTGG - Intergenic
1181853550 22:25766998-25767020 GGTTTGAATGCAAGAGGAGGGGG + Intronic
1181960946 22:26621487-26621509 GCTTCAACTGGAAGAGAAAGGGG + Intergenic
1182354195 22:29714941-29714963 GGTCCTGCTGGGAGAGAAGGAGG + Intergenic
1184234145 22:43174124-43174146 GGTGCTCATGGAGGAGCAGGCGG + Intronic
1203301297 22_KI270736v1_random:78946-78968 GAGTCTAATGGAAGGGAGGGGGG + Intergenic
949212067 3:1514905-1514927 GGTACTATTTGAAGAGAAGTAGG + Intergenic
949609964 3:5693810-5693832 AGTTCTGAGGGAAGAGAAAGTGG + Intergenic
950581398 3:13864520-13864542 GGATCTAGTGGAAGAGAAACAGG - Intronic
952553851 3:34509492-34509514 GGTTGTAAGGAATGAGAAGGAGG - Intergenic
952932913 3:38374097-38374119 GGCAGTAATGGAAAAGAAGGGGG - Intronic
953403117 3:42644077-42644099 GCTGCTAGTGGAAGAGAAAGTGG + Intronic
954089923 3:48276171-48276193 AGTTCTGAGGGAAGAGAAAGTGG - Intronic
954210215 3:49093079-49093101 GTTTCTAATGAAAGATAAGCAGG + Intronic
956288887 3:67640716-67640738 GGTTCTAATGAAAGAAAAAAAGG - Intronic
956675761 3:71730510-71730532 GCTGCTAATGGAAGAGAAAGGGG + Intronic
958878448 3:99641763-99641785 GGGTCTGGTTGAAGAGAAGGAGG - Intronic
959791655 3:110368862-110368884 GGTTCGATTGGAAGATAATGGGG - Intergenic
960240948 3:115341415-115341437 GGTTTGAATGGAGGAGTAGGAGG + Intergenic
961104925 3:124232754-124232776 GGTTCAGATGGAAGGGAAGGAGG - Intronic
961124553 3:124404876-124404898 GGTTTTTATGGAAGAAAAAGTGG - Intronic
963442422 3:145356655-145356677 AGTTCTGAGGGAAGAGAAGGTGG + Intergenic
963542340 3:146608379-146608401 GGCTGGAATGGAAGAAAAGGGGG - Intergenic
963660827 3:148127078-148127100 AGTTCTAAAGGTAGAGAAGCTGG - Intergenic
964612085 3:158625601-158625623 AGTTCTGAAGGAAGAGAAAGTGG + Intergenic
967109216 3:186278578-186278600 GGTTCTAAGGAATAAGAAGGGGG + Intronic
967322990 3:188212558-188212580 TGATCTATTGGAAGAGAGGGAGG + Intronic
969376306 4:6765645-6765667 GGTTTCACTGGAAGGGAAGGAGG - Intergenic
971825694 4:31619561-31619583 GGTTCAAAGGGAAAAGAAAGTGG - Intergenic
972557563 4:40196044-40196066 CACTCTAATGGATGAGAAGGAGG - Intronic
973887874 4:55341313-55341335 TGTTTTAAGGGAAGAGAAGGTGG - Intergenic
975730802 4:77335383-77335405 GGTTCTAAGGGAAGAGAAAGTGG + Intronic
981752032 4:148102138-148102160 GCTGCTAAAGGAAGAAAAGGAGG - Intronic
981871610 4:149493610-149493632 CTTTCTAAAGGAAGAGAAGGAGG + Intergenic
985212187 4:187607086-187607108 GGTTCTTATGGAGGAGAGGCTGG + Intergenic
986228685 5:5841448-5841470 GGTTCTAATGGACAAGATGATGG + Intergenic
987784561 5:22483039-22483061 GGTGGTAGTTGAAGAGAAGGGGG - Intronic
990200382 5:53366243-53366265 GGTTCTCCTGGAAGAGAAAATGG + Intergenic
990465421 5:56066986-56067008 GTTTTTAGAGGAAGAGAAGGAGG - Intergenic
990486267 5:56261827-56261849 GGTTCTATGGGAAGAGAGGAGGG + Intergenic
991388481 5:66116480-66116502 AGGTCTGATGGAAGGGAAGGAGG - Intergenic
993548165 5:89239269-89239291 GATTATAATGGAAGAAAAGATGG - Intergenic
994322940 5:98414291-98414313 GGTAAGAATGGAAGAGCAGGAGG - Intergenic
994852253 5:105070743-105070765 GCTTCTAATCTAAGAGAAAGGGG + Intergenic
995495765 5:112740990-112741012 GATTCTAATACAAGAAAAGGGGG - Intronic
997317775 5:132952054-132952076 GTTTGTAATGGCAGAGAAAGGGG - Intronic
998966367 5:147545167-147545189 GGTTCATATGGACCAGAAGGAGG + Intergenic
1000138579 5:158379779-158379801 GGTTCTAAAGGATGAGGATGTGG + Intergenic
1000365251 5:160484713-160484735 GGTTCTATTAGTATAGAAGGAGG + Intergenic
1000759799 5:165208084-165208106 GCTTCTCATTGCAGAGAAGGAGG + Intergenic
1000969348 5:167696837-167696859 GGTGAGAATGGAAGAGGAGGAGG - Intronic
1001086714 5:168705452-168705474 GGTGCTAATGGTACAGATGGTGG - Intronic
1001239443 5:170056913-170056935 GGCCCTAATGGAAGAGATTGGGG - Intronic
1004296776 6:14419442-14419464 TGTTAAAATAGAAGAGAAGGAGG - Intergenic
1005209336 6:23442647-23442669 GGTGGGAATGGAAGAGAAGGGGG - Intergenic
1005956161 6:30664989-30665011 GCTCCTAAGGAAAGAGAAGGAGG + Exonic
1005987991 6:30885940-30885962 GGTTGTAATGGAGTGGAAGGGGG + Intronic
1006145763 6:31958772-31958794 GGTTTGAACGGCAGAGAAGGCGG + Intronic
1006319977 6:33314497-33314519 GGTTCTCATGGAGGAGTGGGTGG - Exonic
1006652546 6:35563533-35563555 GGTTTTAAGAGAAGAGAAAGTGG + Intergenic
1007244131 6:40447885-40447907 GATTCTAATGGAGGAGAACAGGG - Intronic
1007419257 6:41709648-41709670 GGATATAATGGATGAAAAGGTGG + Intronic
1008423161 6:51326560-51326582 GGTTGTAATGTTATAGAAGGGGG + Intergenic
1008900071 6:56603256-56603278 GTTGCTGAGGGAAGAGAAGGCGG + Intronic
1010367732 6:75071507-75071529 GGTTTTAATCTAAGAGAAGTGGG - Intergenic
1011212044 6:84965500-84965522 AGTTCTGAGGGAAGAGAAAGTGG + Intergenic
1011666435 6:89638971-89638993 AGTTCAAATGAAAGTGAAGGAGG + Intergenic
1013214343 6:108014027-108014049 GCTTCCACTGGAGGAGAAGGAGG + Intergenic
1013852713 6:114535027-114535049 GGATCCAATGGGAGAGAAGCAGG - Intergenic
1015102279 6:129495586-129495608 TGTTCTAGTGGTAGAGAAGAAGG - Intronic
1016085760 6:139912387-139912409 AGTTATAATGGAAGAGTATGTGG + Intergenic
1018363578 6:163096670-163096692 AGTTCTACTTGGAGAGAAGGAGG + Intronic
1019534267 7:1520368-1520390 GGTCCAACTGGAACAGAAGGTGG + Intergenic
1019829427 7:3311920-3311942 GGGTCTCATGGAGGAGTAGGAGG + Intronic
1020734461 7:11929909-11929931 GGTTTTAATCCAAGATAAGGAGG + Intergenic
1020796653 7:12685613-12685635 CGTTCTGATGGAGGAGGAGGTGG + Intergenic
1021817219 7:24459319-24459341 GGCTCTACTGGAAGGGAGGGTGG - Intergenic
1024971681 7:55077709-55077731 GGCTCTCATGGAAGAGCGGGAGG + Intronic
1026800596 7:73397721-73397743 GGTGCTGGAGGAAGAGAAGGGGG + Intergenic
1027534817 7:79385179-79385201 TGTTGTAATGGACTAGAAGGCGG + Intronic
1029965808 7:104739448-104739470 GATTCTAAAGGAAGAGAGGTTGG + Intronic
1030130540 7:106195787-106195809 GTTTCTACTTGAAGAGAAGTAGG - Intergenic
1031076428 7:117217521-117217543 GGTTCTAATGAGAGAGATGTTGG + Intronic
1031180168 7:118404202-118404224 TGGTCTAATGGAAAAGAAGATGG - Intergenic
1031697750 7:124879590-124879612 AGTTAAAATGGAAGAGCAGGGGG + Intronic
1035332755 7:158107136-158107158 GGAGGTAAGGGAAGAGAAGGGGG - Intronic
1037935680 8:22913585-22913607 GCTTCTGAGGGAAGAGGAGGAGG - Intronic
1039463731 8:37767348-37767370 GGTTCTTGAGGAAGAGAAGTGGG - Intronic
1039893236 8:41698309-41698331 GGTTCTAAAGGTAGAGAAAGGGG - Intronic
1039898128 8:41730775-41730797 GGCTCCCATGGAAAAGAAGGAGG + Intronic
1041647766 8:60271093-60271115 GGTTCTAAGGGAAGCCAAGGCGG + Intronic
1041704139 8:60827636-60827658 TATTCAAAGGGAAGAGAAGGAGG + Intronic
1042315805 8:67424652-67424674 GGTTCTAAAGCAAAAGAAAGAGG - Intronic
1042654271 8:71078642-71078664 GGTTCTACTGGAAGGGAAGAAGG + Intergenic
1043159783 8:76831756-76831778 GGTTCTGAGGGAAGAATAGGAGG + Intronic
1044030959 8:87236644-87236666 GGTTCTAGTGGAAGAAAACATGG - Intronic
1045373127 8:101544987-101545009 TGTTTTAATGGGAAAGAAGGTGG - Intronic
1045546686 8:103135601-103135623 GATTGTAATGCAAGAAAAGGGGG - Intronic
1046079345 8:109352199-109352221 AATTCTAATGGAAGAGAGGGAGG - Intergenic
1047938306 8:129803084-129803106 GGTTCTTAGGGAACAGAAAGAGG + Intergenic
1050626618 9:7510990-7511012 GGTTCTGGTGGGAGATAAGGTGG + Intergenic
1051540977 9:18217101-18217123 GGCTCTAAAGGAAGAGAGAGGGG + Intergenic
1052503690 9:29325490-29325512 CTTCCAAATGGAAGAGAAGGGGG + Intergenic
1053342408 9:37348776-37348798 GGTGTAAATGGAAGACAAGGTGG - Intronic
1056318772 9:85417304-85417326 GGTTCTATTAGCAGGGAAGGAGG - Intergenic
1059438957 9:114292038-114292060 GGTTCTAAGGCAGGAGGAGGCGG - Intronic
1060273403 9:122164180-122164202 TTTTAAAATGGAAGAGAAGGAGG + Intronic
1186804174 X:13123131-13123153 GGTGCTAAATGAAGGGAAGGAGG - Intergenic
1187951457 X:24474929-24474951 TGTTCTAAAGGAAAAGAAGATGG - Intronic
1188612359 X:32116112-32116134 GATTCCAGTGTAAGAGAAGGTGG - Intronic
1189898653 X:45682793-45682815 AGATCCAATGGAAGTGAAGGTGG - Intergenic
1189986745 X:46559957-46559979 AGCTCTAATGGATGAAAAGGTGG - Intergenic
1190311853 X:49122519-49122541 GATTCTAAAGGAAGAATAGGAGG + Exonic
1190490609 X:50979233-50979255 GGGTGTAAAGGAAGAAAAGGAGG - Intergenic
1191889984 X:65929631-65929653 TGTTTTAAGGGAAGAGAAGGTGG + Intergenic
1191898234 X:66015716-66015738 GGTTCTAATGGAGGGGAAAAGGG + Intergenic
1192340417 X:70259270-70259292 GGTTCCAATAGAAAAGAAAGCGG + Exonic
1192860918 X:75069542-75069564 GGATATAATGGAAAAGAAGGAGG + Intronic
1195714982 X:107809832-107809854 GGTTATAATGAGAGAGAAGGAGG - Intergenic
1198079757 X:133228104-133228126 AGTTGGAGTGGAAGAGAAGGGGG + Intergenic
1201940082 Y:19449812-19449834 GGTCCTAAGGGAAGAGAAAGTGG - Intergenic
1202038450 Y:20658897-20658919 GGGTCTGAGGGAAGAGGAGGAGG - Intergenic
1202097036 Y:21262651-21262673 GGTTTTACTGGGAGAGAAGGGGG + Intergenic