ID: 1157870294

View in Genome Browser
Species Human (GRCh38)
Location 18:51224104-51224126
Sequence CTCTTGAAATGTAAGATATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157870294_1157870297 1 Left 1157870294 18:51224104-51224126 CCCTATATCTTACATTTCAAGAG No data
Right 1157870297 18:51224128-51224150 GCAGGAAAGATACTCTTTCCTGG No data
1157870294_1157870300 25 Left 1157870294 18:51224104-51224126 CCCTATATCTTACATTTCAAGAG No data
Right 1157870300 18:51224152-51224174 AGGCTGTCAGTGCCTCTCATTGG No data
1157870294_1157870298 5 Left 1157870294 18:51224104-51224126 CCCTATATCTTACATTTCAAGAG No data
Right 1157870298 18:51224132-51224154 GAAAGATACTCTTTCCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157870294 Original CRISPR CTCTTGAAATGTAAGATATA GGG (reversed) Intergenic
No off target data available for this crispr