ID: 1157870931

View in Genome Browser
Species Human (GRCh38)
Location 18:51229574-51229596
Sequence GATAGCTCTTGGTCTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157870931_1157870934 11 Left 1157870931 18:51229574-51229596 CCAGTAGCAGACCAAGAGCTATC No data
Right 1157870934 18:51229608-51229630 GATTAGTTACCTGCAGAAGATGG No data
1157870931_1157870935 16 Left 1157870931 18:51229574-51229596 CCAGTAGCAGACCAAGAGCTATC No data
Right 1157870935 18:51229613-51229635 GTTACCTGCAGAAGATGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157870931 Original CRISPR GATAGCTCTTGGTCTGCTAC TGG (reversed) Intergenic
No off target data available for this crispr