ID: 1157878323

View in Genome Browser
Species Human (GRCh38)
Location 18:51294369-51294391
Sequence CATACCACCTCCAAGGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157878319_1157878323 -10 Left 1157878319 18:51294356-51294378 CCTGGGAGCACTTCATACCACCT No data
Right 1157878323 18:51294369-51294391 CATACCACCTCCAAGGGGTTTGG No data
1157878316_1157878323 3 Left 1157878316 18:51294343-51294365 CCCCATATGTCGGCCTGGGAGCA No data
Right 1157878323 18:51294369-51294391 CATACCACCTCCAAGGGGTTTGG No data
1157878312_1157878323 13 Left 1157878312 18:51294333-51294355 CCTTTTCACTCCCCATATGTCGG No data
Right 1157878323 18:51294369-51294391 CATACCACCTCCAAGGGGTTTGG No data
1157878317_1157878323 2 Left 1157878317 18:51294344-51294366 CCCATATGTCGGCCTGGGAGCAC No data
Right 1157878323 18:51294369-51294391 CATACCACCTCCAAGGGGTTTGG No data
1157878308_1157878323 28 Left 1157878308 18:51294318-51294340 CCGCCTTACTCCTTCCCTTTTCA No data
Right 1157878323 18:51294369-51294391 CATACCACCTCCAAGGGGTTTGG No data
1157878318_1157878323 1 Left 1157878318 18:51294345-51294367 CCATATGTCGGCCTGGGAGCACT No data
Right 1157878323 18:51294369-51294391 CATACCACCTCCAAGGGGTTTGG No data
1157878310_1157878323 18 Left 1157878310 18:51294328-51294350 CCTTCCCTTTTCACTCCCCATAT No data
Right 1157878323 18:51294369-51294391 CATACCACCTCCAAGGGGTTTGG No data
1157878307_1157878323 29 Left 1157878307 18:51294317-51294339 CCCGCCTTACTCCTTCCCTTTTC No data
Right 1157878323 18:51294369-51294391 CATACCACCTCCAAGGGGTTTGG No data
1157878311_1157878323 14 Left 1157878311 18:51294332-51294354 CCCTTTTCACTCCCCATATGTCG No data
Right 1157878323 18:51294369-51294391 CATACCACCTCCAAGGGGTTTGG No data
1157878309_1157878323 25 Left 1157878309 18:51294321-51294343 CCTTACTCCTTCCCTTTTCACTC No data
Right 1157878323 18:51294369-51294391 CATACCACCTCCAAGGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157878323 Original CRISPR CATACCACCTCCAAGGGGTT TGG Intergenic
No off target data available for this crispr