ID: 1157879584

View in Genome Browser
Species Human (GRCh38)
Location 18:51307895-51307917
Sequence CTGTGATTGTAAGTTTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157879584_1157879591 15 Left 1157879584 18:51307895-51307917 CCTCAGAAAACTTACAATCACAG No data
Right 1157879591 18:51307933-51307955 ACAGGTCCTTCATCACATGGTGG No data
1157879584_1157879592 19 Left 1157879584 18:51307895-51307917 CCTCAGAAAACTTACAATCACAG No data
Right 1157879592 18:51307937-51307959 GTCCTTCATCACATGGTGGCAGG 0: 5
1: 178
2: 561
3: 993
4: 1869
1157879584_1157879594 23 Left 1157879584 18:51307895-51307917 CCTCAGAAAACTTACAATCACAG No data
Right 1157879594 18:51307941-51307963 TTCATCACATGGTGGCAGGAAGG 0: 3
1: 183
2: 751
3: 1178
4: 1789
1157879584_1157879590 12 Left 1157879584 18:51307895-51307917 CCTCAGAAAACTTACAATCACAG No data
Right 1157879590 18:51307930-51307952 CAAACAGGTCCTTCATCACATGG No data
1157879584_1157879589 -3 Left 1157879584 18:51307895-51307917 CCTCAGAAAACTTACAATCACAG No data
Right 1157879589 18:51307915-51307937 CAGTGGAAGGGGAAGCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157879584 Original CRISPR CTGTGATTGTAAGTTTTCTG AGG (reversed) Intergenic
No off target data available for this crispr