ID: 1157879589

View in Genome Browser
Species Human (GRCh38)
Location 18:51307915-51307937
Sequence CAGTGGAAGGGGAAGCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157879584_1157879589 -3 Left 1157879584 18:51307895-51307917 CCTCAGAAAACTTACAATCACAG No data
Right 1157879589 18:51307915-51307937 CAGTGGAAGGGGAAGCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157879589 Original CRISPR CAGTGGAAGGGGAAGCAAAC AGG Intergenic
No off target data available for this crispr