ID: 1157882183

View in Genome Browser
Species Human (GRCh38)
Location 18:51330978-51331000
Sequence CCTTCAGAGAGAGCTGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157882183_1157882186 -9 Left 1157882183 18:51330978-51331000 CCCAGAGCAGCTCTCTCTGAAGG No data
Right 1157882186 18:51330992-51331014 CTCTGAAGGCTGTTTTTCCGTGG No data
1157882183_1157882188 4 Left 1157882183 18:51330978-51331000 CCCAGAGCAGCTCTCTCTGAAGG No data
Right 1157882188 18:51331005-51331027 TTTTCCGTGGTGTGCAGCGGAGG No data
1157882183_1157882187 1 Left 1157882183 18:51330978-51331000 CCCAGAGCAGCTCTCTCTGAAGG No data
Right 1157882187 18:51331002-51331024 TGTTTTTCCGTGGTGTGCAGCGG No data
1157882183_1157882190 9 Left 1157882183 18:51330978-51331000 CCCAGAGCAGCTCTCTCTGAAGG No data
Right 1157882190 18:51331010-51331032 CGTGGTGTGCAGCGGAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157882183 Original CRISPR CCTTCAGAGAGAGCTGCTCT GGG (reversed) Intergenic