ID: 1157887168

View in Genome Browser
Species Human (GRCh38)
Location 18:51379909-51379931
Sequence GACCCAGTCAATGTTCCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157887168_1157887171 28 Left 1157887168 18:51379909-51379931 CCCGTGGGAACATTGACTGGGTC No data
Right 1157887171 18:51379960-51379982 CTGCAGATCTGAAAGTTGGAAGG No data
1157887168_1157887172 29 Left 1157887168 18:51379909-51379931 CCCGTGGGAACATTGACTGGGTC No data
Right 1157887172 18:51379961-51379983 TGCAGATCTGAAAGTTGGAAGGG No data
1157887168_1157887170 24 Left 1157887168 18:51379909-51379931 CCCGTGGGAACATTGACTGGGTC No data
Right 1157887170 18:51379956-51379978 AGAACTGCAGATCTGAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157887168 Original CRISPR GACCCAGTCAATGTTCCCAC GGG (reversed) Intergenic
No off target data available for this crispr