ID: 1157887197

View in Genome Browser
Species Human (GRCh38)
Location 18:51380281-51380303
Sequence CATGAGCCTCAAAATGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157887197_1157887199 -7 Left 1157887197 18:51380281-51380303 CCCTGATCATTTTGAGGCTCATG No data
Right 1157887199 18:51380297-51380319 GCTCATGAAAGACTACCCTAAGG No data
1157887197_1157887203 19 Left 1157887197 18:51380281-51380303 CCCTGATCATTTTGAGGCTCATG No data
Right 1157887203 18:51380323-51380345 TGCTGTTTGAGCTAAAATTTGGG No data
1157887197_1157887202 18 Left 1157887197 18:51380281-51380303 CCCTGATCATTTTGAGGCTCATG No data
Right 1157887202 18:51380322-51380344 GTGCTGTTTGAGCTAAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157887197 Original CRISPR CATGAGCCTCAAAATGATCA GGG (reversed) Intergenic
No off target data available for this crispr